http://chineseinput.net/에서 pinyin(병음)방식으로 중국어를 변환할 수 있습니다.
변환된 중국어를 복사하여 사용하시면 됩니다.
오늘 본 자료
박혜경,권창익,엄태훈,김예순,노연숙,정규혁,이의경,Park, Hye-Kyung,Kwon, Chang-Ik,Eom, Tae-Hoon,Kim, Ye-Soon,Rho, Yeun-Sook,Jeong, Gyu-Hyeok,Lee, Eui-Kyoung 대한약학회 2008 약학회지 Vol.52 No.6
The purpose of this study is to analyze the factors affecting financial performance of community pharmacies after the implementation of the new drug policy in Korea: separation of drug prescription and dispensing (SPD). The online survey questionnaires were sent to the active pharmacists of the total 20,633 community pharmacies in Korea and 1,147 pharmacists responded to the survey (the response rate was 5.5%). The questionnaire asked simple financial data in order to compare their financial performances before and after the policy. With the SPSS package (version 12.0), two levels of data analysis were used: 1) descriptive statistics to see the financial status of the pharmacies; and 2) multiple regression analysis to find the factors. {or A multiple regression method was used for the data analysis.} The finding illustrated that the average net benefit of the pharmacies was 4,870 thousand won in August 2006, and the major factors affecting the net benefit were the location of pharmacy (geographical proximity to medical institutions), number of prescriptions, drug management services for patients, chain pharmacy membership. The findings of this study suggest that service improvement for patients, revitalization of non-prescription drug sales, professional management will contribute to promote community based pharmacy business.
열성경련 플러스에서 SCN1A-exon 9의 단일염기다형성
노석만(Suk-Man Roh) 엄태훈(Tae-Hun Eom) 김진모(Jinmo Kim) 김영훈(Young-Hoon Kim) 정승연(Seung-Yun Chung) 이인구(In-Goo Lee) 황경태(Kyung-Tai Whang) 이권행(Kweon-Haeng Lee) 대한소아신경학회 2004 대한소아신경학회지 Vol.12 No.1
목적 : 열성경련은 6세 이하 소아와 2-5%에서 경험하는 비교적 흔한 질환이다. 열성경련을 경험한 소아의 일부는 나중에 비열성경련성질환과 간질로 발전한다. 열성경련 플러스(generalized epilepsy with febrile seizure plus, GEFS+)는 열성경련과 다양한 정도의 전신발작 등 이질적인 표현형을 가진 중요한 유전학적간질증후군이다. 전압관문나트륨채널 아형(voltage-gated sodium, channel subunit) 유전자인 SCN1A의 돌연변이는 열성경련 플러스(GEFS+)를 보이는 상염색체우성 전신간질과 중증 근간대성 간질을 보이는 영아의 열성경련과 관련이 있는 것으로 알려지고 있다. 저자들은 GEFS+와 열성경련으로 진단받은 환아를 대상으로 SCN1A 유전자의 다형성을 알아보기 위하여 본 연구를 시행하였다. 방법 : 가톨릭대학교 의정부성모병원 및 성모자애병원 소아과에서 GEFS+로 진단받은 환아 22명과 열성경련 환아 62명을 대상으로 하여 SCN1A 유전자의 돌연변이를 분석하였다. SCN1A 유전자 exon 9의 증폭은 primer쌍(Foward GGAGGGTGAGACGCTGACTC, Reverse CACCTGGAGCTCCCCAGCTG)을 가지고 touchdown PCR 방법을 수행하였으며 DHPLC를 이용하여 exon 9의 1212에서 SNP(G/A)을 확인하였다. 이후 DHPLC에 의하여 분석된 각 유형에 대하여 염기서열법을 시행하였다. 결과 : 두 가족을 포함한 대상 총 84명 중 GEFS+ 환아군은 22명, 열성경련 환아군은 62명이었다. 열성경련의 형태는 GEFS+ 환아군에서는 단순열성경련 5명, 복합열성경련 17명, 열성경련 환아군에서는 단순열성 49명, 복합열성경련 13명이었다. 열성경련 환아군에서 간질이나 열성경련의 가족력이 있었던 환아는 43.5%이었다. 연령 분포를 보면 평균연령은 GEFS+ 환아군에서 9.1세였으며 12개월에서 33개월 미만 22.74%, 36개월 이상 7세 미만이 18.2%, 7세 이상이 59.1%이었고, 열성경련 환아군에서 2.4세이었으며 12개월 미만 11.3%, 12개월에서 36개월 미만 46.8%, 36개월 이상 7세 미만이 41.9%이었다. 남녀비는 GEFS+ 환아군에서 1.75:1이며 열성경련 환아군에서 1.82:1이었다. SCN1A exon 9의 돌연변이 검사상 exon 9의 1212의 위치에 SNP(G/A)은 84명 중 11명에서 발견되었고 intron부분에서 SNP(G/A)는 84명 중 52명에서 발견되었다. 동종접합유전자형(G/G)에서 intron A/A는 73명 증 22명에서 intron G/G는 5명에서 발견되었다. 이중 이미 보고된 exon 9의 1212에서 돌연변이(1212 G/A intron G/G)는 84명 중 5명이었다. GEFS+와 열성경련 환아에서 1212 G/G intron A/A 또는 G/G, 1212 G/G intron G/A, 1212 G/A intron G/A, 이미 보고된 1212 G/A의 단일염기다형성 빈도에는 통계학적으로 유의한 차가 없었다. 결론 : 비록 GEFS+환아와 열성경련 환아에서 SCN1A유전자의 exon9 다형성이 현저한 차이가 없는 것으로 나왔지만 임상적 인자를 고려한 광범위한 연구가 필요하다 Purpose : Febrile seizures affect 2-5% of all children younger than 6 years old. A small proportion of children with febrile seizures later develop epilepsy. Muations in the voltage-gated sodium channel subunit gene SCN1A have been associated with febrile seizures(FSs) in autosomal dominant generalized epilepsy with febrile seizures plus (GEFS +) families and severe myoclonic epilepsy of infancy. The present study assessed the role of SCN1A in familial typical FSs. Methods: 22 GEFS+ and 62 FSs were selected throughout a collaborative study of Catholic Child Neurology Research Group. The exon 9 region of SCN1A was screened by DHPLC. DNA fragments showing variant chromatograms were subsequently sequenced. Results: A total 84 individuals(22 GEFS+ and 62 FSs) was screened for mutations. Among 22 GEFS+ and 62 FSs patients, five and forty nine showed simple FSs, and seventeen and thirteen had complex FSs. 0% and 8.3% were younger than 12 months old, 22.7% and 46.8% were between 12 and 35 months old, 18.2% and 41.9% were between 36 and 83 months old, and 59.1% and 0% were older than 84 months old. The ratios of male to female were 1.75: 1 and 1.82: 1. Mutational analysis detected no mutation of SCN1A. Mutational analysis detected eleven silent exonic polymorphisms at G1212A in exon 9 and forty two polymorphisms on intron 9, and 23 intron A/As in 73 homozygote samples. There were no significant differences in allelic frequencies(G/G intron A/A or G/G, G/G intron G/A, G/A intron G/A, reported G/A) of G1212A in SCN1A-exon 9 between the patients with GEFS+ and FSs(31.8% vs. 32.3%, 54.5% vs. 54.8%, 9% vs. 6.5%, 4.5% vs. 6.5%). Conclusion : Although our study demonstrated that SCN1A is not frequently involved in GEFS+ and FSs, further systemic research would be necessary.
Hand, Foot, and Mouth Disease Neurologic Complications: Clinical Features and Parameters
김지수(Ji Soo Kim),엄태훈(Tae Hoon Eom),김성준(Seong Joon Kim),빈중현(Joong Hyun Bin),김영훈(Young Hoon Kim) 대한소아신경학회 2014 대한소아신경학회지 Vol.22 No.3
Purpose: Hand, foot, and mouth disease (HFMD) is a common childhood illness. Enterovirus 71 (EV71) epidemics have recently been associated with HFMD-based neurologic complications in the Asia-Pacific region. This study described HFMD clinical features, and investigated clinical parameters in patients presenting with acute neurologic complications associated with HFMD. Methods: We retrospectively reviewed medical records from 235 hospitalized patients who developed HFMD with or without neurologic complications (22 and 213 cases, respectively) in Uijengbu, Korea between 2010 and 2013. Clinical manifestations, radiologic findings, cerebrospinal fluid (CSF) analyses, virological analyses, and treatment regimens were summarized. Additionally, routinely collected baseline data from 235 patients were retrospectively analyzed to identify clinical parameters associated with neurologic complications. Results: Brainstem encephalitis was the most frequent neurologic complication (11 cases), followed by aseptic meningitis (seven cases). We also found acute disseminated encephalomyelitis and meningitis retention syndrome. Both have rarely been reported in EV71-associated HFMD. Virological analyses were performed for 15 cases, and 14 demonstrated EV71 infection, while one patient demonstrated Coxsackievirus B3 infection. Multivariate logistic regression analysis indicated patients were more likely to develop neurologic complications if they experienced nausea/vomiting (OR= 13.65, P<0.001) and lethargy (OR=10.68, P=0.003). Males were more likely to develop neurologic complications compared to females (OR=2.12, P=0.005). In addition, neurologic complications were associated with a higher peak heart rate (OR=1.13, P=0.001). Conclusion: This study revealed usual and unusual findings of HFMD-associated neurologic complications. Male gender, nausea/vomiting, lethargy, and peak heart rate parameters predicted HFMD-associated neurologic complications. However, laboratory findings did not reliably predict HFMD-associated neurologic complications.
Articulation Patterns of Children who Developed Articulation Disorders Associated with Ankyloglossia
박선영(Sun-Young Park),심선희(Sun-Hee Shim),장은실(Eun-Sil Jang),엄태훈(Tae-Hoon Eom),김영훈(Young-Hoon Kim),이순주(Soon-Ju Lee) 대한소아신경학회 2013 대한소아신경학회지 Vol.21 No.3
목 적 : 설소대와 조음장애의 관련성과 설소대 환아에서 조음장애 유무를 감별하는데 필요한 임상지침을 제시하기 위해 조음장애를 동반한 설소대 환아의 조음양상의 특징을 알아보고자 하였다. 방 법: 2002년 1월부터 2012년 12월까지 의정부성모병원 소아청소년과 외래를 방문한 124명의 환아 중 설소대를 제외한 다른 조음기관의 해부학적 이상, 신경학적 질환이나 발달/언어지연을 가진 46명의 환아를 제외한 총 78명을 설소대 유무에 따라 각각 환자군 23명과 대조군 55명으로 나누어 그림자음검사를 통해 조음양상을 비교분석하였다. 결 과 : 두 군에서 조음오류를 보인 자음유형에 따라 집계한 각 환자수는 연구개비음의 경우에만 차이를 보였다. 하지만 자음유형에 따른 조음오류의 환자별 관찰빈도수의 총합은 양순파열음, 연구개파열음과 연구개비음에서 유의한 차이를 보였다. 조음오류의 변화유형에 따라 집계한 환자수는 두 군에서 차이를 보이지 않았다. 하지만 조음변화 유형에 따른 환자별 관찰빈도수의 총합은 환자군에서 전설음화와 마찰음화가 낮게 관찰되었고, 경음화와 격음화과 높게 관찰되었다. 결 론 : 본 연구를 통해 설소대를 동반한 조음장애 환아의 일부에서 해부학적 이상을 동반하지 않은 기능적 조음장애 환아와 구별되는 특징을 보이는 결과를 관찰할 수 있었지만, 이를 설소대를 동반한 모든 조음장애 환아로 일반화할 수는 없었다. 따라서 설소대와 조음장애의 관련성은 여전히 논란의 여지가 있으며, 또한 수술적 치료를 포함한 설소대 치료를 결정하는데 주의를 기울여야 할 것으로 사료된다. Purpose : We investigated articulation patterns in children with ankyloglossia who developed articulation disorders in order to determine the relationship between ankyloglossia and articulation disorders, and to clinically detect children who have articulation disorders associated with ankyloglossia. Methods : The participants of this study were 23 children with articulation disorders that accompanied ankyloglossia and 55 controls with functional articulation disorders independent of anatomical problems, who were admitted to our hospital from January 1, 2002 to December 31, 2012. All children underwent speech-language pathologic evaluation using the Picture Consonant Articulation Test (PCAT; Young-Tae Kim, 1994). We retrospectively compared collected data between the subject and control groups using Fisher's exact test and odds ratio tests with a 95% confidential interval for categorical variables and the independent Mann-Whitney U-test for continuous variables. Results : The number of patients with articulation errors in the velar nasal was lower significantly only in the subject group (P =0.038). The total numbers of articulation errors in the bilabial plosive, velar plosive and velar nasal also were lower (P=0.007, P˂0.001, and P=0.034, respectively). There were no differences in the numbers of patients with articulation errors according to phonological changes between the two groups. However, the total numbers of fronting and frication were lower in the subject group (both P˂0.001), but the total numbers of plosivation and tensing were higher (P =0.002 and P =0.008, respectively). Conclusion : This study showed that the relationship between an articulation disorder and ankyloglossia is doubtful, although some results suggest that ankyloglossia may cause articulation errors only in certain individuals. Therefore, clinicians should be careful when determining the relationship between ankyloglossia and articulation disorders and use caution when making a treatment decision.
결신 발작에서 이차 약제로서 Valproate와 Lamotrigine의 치료 효과
빈중현(Joong Hyun Bin),박선영(Sun Young Park),한지윤(Ji Yoon Han),엄태훈(Tae Hoon Eom),김성준(Seong Joon Kim),김영훈(Young Hoon Kim),이인구(In Goo Lee),정승연(Seung Yun Chung) 대한소아신경학회 2014 대한소아신경학회지 Vol.22 No.2
목적: ESX로 치료하고 잘 조절되고 있던 소아청소년기 결신 발작환자에서 ESX 치료가 중단되어 VPA와 LTG로 대체하였을 때 치료 효과를 비교하고자 하였다. 방법: 2010년 1월부터 2012년 12월까지 가톨릭대학교 서울성모병원, 인천성모병원, 부천성모병원, 의정부성모병원, 성빈센트병원 소아청소년과를 통해 소아청소년기 결신 발작으로 진단 받고 일차 치료제로 ESX를 사용하였다가 ESX 사용 중단으로 이차 치료제인 VPA와 LTG로 대체한 34명의 환자를 대상으로 하였다. 소아청소년기 결신발작의 임상양상과 특징적인 뇌파 소견을 기준으로 선정하였고 치료약제 변경에 따른 발작 감소율과 약제에 대한 부작용 등을 후향적으로 조사하였다. 결과: 전체 34명의 환자 중 17명(50.0%)이 이차 치료제로 VPA를, 17명(50.0%)이 LTG를 사용하였다. 이차 치료제로 치료 시작 후 3개월 동안 발작이 완전히 조절된 환자는 전체 20명(58.8%)이였고, 이중 VPA로 치료 받은 환자는 13명(76.5%), LTG로 치료 받은 환자는 7명(41.2%)이었다. 이차 치료제를 사용하였으나 발작이 잘 조절되지 않거나 부작용에 의해 다른 약으로 대체한 경우는 이차 치료제로 VPA 치료한 환자는 4명(23.5%), LTG로 치료한 환자는 10명(58.8%)이었다. 이차 치료제로 VPA와 LTG를 사용하여 3개월 동안 발작이 완전히 조절되는 치료 효과를 비교하였을 때 VPA가 LTG에 비해 더 좋은 결과를 보였다(P=0.04). 결론: ESX로 치료하고 잘 조절되고 있던 소아청소년기 결신 발작환자에서 부득이한 이유로 ESX를 사용할 수 없을 때 이차 치료제로 VPA 사용이 추천된다. Purpose: Ethosuximide (ESX) is currently not available due to various reasons in Korea. The aim of this study is to compare the efficacy of valproate (VPA) and lamotrigine (LTG) when ESX monotherapy was replaced by VPA or LTG. Methods: A retrospective study was done for a total of 34 patients treated with ESX in 5 different hospitals affiliated with Catholic University of Korea from January, 2010 to December, 2012. They all were initially treated with ESX, but later switched to VPA or LTG. The subjects were selected based on clinical symptoms and electroencephalography findings. Results: Among 34 patients, VPA was prescribed to 17 patients (50.0%) and LTG to 17 patients (50.0%). Twenty patients (58.8%) achieved the seizure freedom after 3 months of the treatments, 13 patients (76.5%) by VPA and 7 (41.2%) by LTG respectively. Four patients (23.5%) with VPA and 10 (58.8%) with LTG were replaced by other anticonvulsants due to ineffectiveness and/or side effects of medication. When we compare the efficacy of seizure reduction between VPA and LTG after 3 month period of the treatment, the efficacy of VPA was better than that of LTG (P=0.04). Conclusion: The results of this study suggest that the VPA is a better alternative anticonvulsant than LTG for the patients with absence epilepsy who are unable to continue ESX.
주의력 결핍 과잉 행동장애가 중복된 뇌전증 소아의 특성
최혜윤(Hye-Yoon Choi),한지윤(Ji-Yoon Han),김성준(Seong-Joon Kim),엄태훈(Tae-Hoon Eom),빈중현(Joong-Hyun Bin),김영훈(Young-Hoon Kim),정승연(Seung-Yun Chung),이인구(In Goo Lee) 대한소아신경학회 2013 대한소아신경학회지 Vol.21 No.3
목 적 : 뇌전증으로 치료 받고 있는 환자에서 ADHD 유병률을 알아보고, 두 질환이 중복되어 있는 환자를 ADHD가 없는 환자와 비교 분석하여 특징을 알아보아 두 질환이 중복되어 있는 환자들의 치료에 도움을 주고자 한다. 방 법: 2009년 3월부터 2012년 5월까지 서울성모병원 소아신경과에 등록되어 뇌전증 진단 하에 항경련제 치료를 받았던 6세에서 18세까지 환자 중에 1년 이상 추적관찰이 가능하였던 184명을 대상으로 의무기록을 분석하였다. 결 과: 1) 대상아 184명중 ADHD가 중복된 환아는 69명으로 37.5%를 차지하고 있었다. 2) ADHD가 중복되지 않은 뇌전증 환아군에서의 남녀 비율은 49:51로 거의 비슷하였으나, ADHD가 중복된 뇌전증 환아군에서는 67:33으로 남자에서의 발생 비율이 여자에 비해 2배 이상 높았다(P=0.022). 3) 뇌파검사에서 ADHD가 중복된 뇌전증 환아들의 병변부위로는 중심부가 39%로 가장 많았다(P=0.014). 4) ADHD가 중복되지 않은 환아들에서는 한 가지 약제로 경련 조절이 가능했던 경우가 56%인 반면 ADHD가 중복된 경우는 36% 이었다(P=0.001). 따라서 뇌전증 환아에서 ADHD의 유무는 항경련제 치료 반응과 관계를 가지고 있으며, 조기에 치료 반응을 예측할 수 있는 유용한 인자 중 하나라고 생각할 수 있다. 결 론:뇌전증 환아에서 ADHD가 중복되는 경우는 ADHD가 중복되지 않은 경우에 비해 여러 특성이 다를 뿐 아니라 뇌전증의 치료 반응도 나쁘기 때문에 ADHD를 조기에 발견하여 대책을 수립하는 것이 필요하다. Purpose : To investigate the prevalence of ADHD (attention-deficit hyperactivity disorder) in children with epilepsy and to determine the difference of characteristics in patients with epilepsy and concomitant ADHD as opposed to the patients without ADHD for better management. Methods : We retrospectively reviewed 184 patients diagnosed as epilepsy and treated with antiepileptic drugs in pediatric neurology department of Seoul St. Mary's hospital from March, 2009 to May, 2012. Their ages ranged from 6 to 18 years. The subjects were included in the study those who made a regular visit for more than a year. Results : 1) Out of 184 patients, 69 patients (37.5%) had both ADHD and epilepsy. 2) In epilepsy children with ADHD, male outnumbered female by almost two fold (male 67: female 33) (P=0.022). 3) In epilepsy children with ADHD, epileptiform discharges on EEG was focused in central regions in 39% of them (P=0.014). 4) In 56% of patients without ADHD, their seizures remained under the control with single anticonvulsant, as opposed to 36% of patients with both ADHD and epilepsy (P=0.001). Therefore, the presence of ADHD in patients with epilepsy might be related to the therapeutic response to anticonvulsants, and be a useful predictive factor for the response to early treatment. Conclusion : Patients with epilepsy and concomitant ADHD showed a significant difference and poor response to epilepsy treatment, as opposed to patients without ADHD. Therefore, early detection and establishment of countermeasures for ADHD is necessary.
소아 일차 두통에서 성별, 나이, 가족력, 어깨 통증의 영향
나현주(Hyun Ju Na),김주현(Joo Hyun Kim),박선영(Sun Young Park),한지윤(Ji Yoon Han),엄태훈(Tae Hoon Eom),빈중현(Joong Hyun Bin),김영훈(Young Hoon Kim),이인구(In Goo Lee),정승연(Seung Yun Chung) 대한소아신경학회 2015 대한소아신경학회지 Vol.23 No.2
목적: 소아 일차 두통에서 성별, 나이, 가족력, 어깨 통증의 영향을 알아보고자 하였다. 방법: 2009년 1월부터 2013년 12월까지 가톨릭대학교 인천성모병원에 두통으로 내원한 319명의 환자를 대상으로 의무기록을 후향적으로 분석하였다. 결과: 두통으로 내원한 환자는 319명이고 이 중 97명이 편두통, 98명이 긴장형 두통으로 진단되었다. 전조 동반 편두통은 35명이였고, 전조 동반하지 않은 편두통은 62명이였다. 두통 환자의 평균 나이는 10.9세였고, 전조 동반한 편두통 환자의 평균 나이는 13.1세(P<0.01)로 다른 두통 환자에 비해 나이가 많았다. 남자 환자는 121명, 여자 환자는 198명으로 남녀 비는 1:1.64였다. 전조 동반한 편두통 환자에서 남녀 비는 1:3.38(P=0.04)로 다른 두통 환자에 비해 여자가 많았다. 어깨 통증 있는 두통 환자는 37.9%였고, 질환에 따른 유의한 차이는 없었다. 두통의 가족력을 가진 환자는 32.3%였고, 질환에 따른 유의한 차이는 없었다. 편두통의 가족력을 가진 환자는 13.2%였고, 전조를 동반하지 않은 편두통 환자는 25.8%(P<0.01)로 다른 두통 환자에 비해 많았다. 엄마의 두통 경력이 있는 환자는 22.6%였고, 전조를 동반하지 않은 편두통 환자는 32.3%(P=0.03)으로 다른 환자에 비해 많았다. 결론: 연령이 많은 환자가 두통에서 차지하는 비중이 높았다. 두통 환자에서 연령이 증가함에 따라 여자가 많아졌다. 전조를 동반한 편두통 환자는 다른 두통 환자에 비해 나이가 많고, 여자가 많았다. 전조를 동반하지 않은 편두통 환자는 다른 두통 환자에 비해 편두통의 가족력이 있는 경우가 많았고, 엄마의 두통 경력이 있는 경우가 많았다. Purpose: Headache is recognized as a common health problem in children and adolescents. We analyzed migraine and tension type headache by sex, age, family history and shoulder pain to find factors influencing each type of headache. Method: This retrospective study was conducted in total 319 patients with headache, who were brought to the Department of Pediatrics of Catholic University Incheon Saint Mary's Hospital from January 2009 to December 2013. Our diagnosis was made using the International Classification of Headache Disorders-II (ICHD-II). Results: In whole study population, 195 patients were identified; 97 were diagnosed with migraine and 98 were diagnosed with tension type headache. Among migraine patients, 35 patients had migraine with aura and 62 had migraine without aura. Mean age of headache patients is 10.9 years old. The type with the oldest mean age was migraine with aura (13.1 years old, P<0.01). Male to female ratio of headache patients is 1:1.64. Female was significantly predisposed to migraine with aura (M:F=1:3.38, P=0.04). Thirty eight percent of patients have shoulder pain. Forty one percent of patients in migraine, 42.9% migraine with aura, 40.3% migraine without aura and 38.8% tension type headache have shoulder pain. Thirty two percent of patients have family history of headache. Thirty seven percent of patients with migraine, 31.4% migraine with aura, 40.3% migraine without aura and 30.6% tension type headache have family history of headache. Conclusion: Although, as many as 32% of headache patients have family history, our study did not reveal the patients with migraine have family history more often than those with tension type headache. Likewise, the incidence of shoulder pain was not significantly different between the patients with migraine and those with tension type headache. Patients having migraine with aura were older age and more female predominant than patients with other types of headache.