http://chineseinput.net/에서 pinyin(병음)방식으로 중국어를 변환할 수 있습니다.
변환된 중국어를 복사하여 사용하시면 됩니다.
오늘 본 자료
열성경련 플러스에서 SCN1A-exon 9의 단일염기다형성
노석만(Suk-Man Roh) 엄태훈(Tae-Hun Eom) 김진모(Jinmo Kim) 김영훈(Young-Hoon Kim) 정승연(Seung-Yun Chung) 이인구(In-Goo Lee) 황경태(Kyung-Tai Whang) 이권행(Kweon-Haeng Lee) 대한소아신경학회 2004 대한소아신경학회지 Vol.12 No.1
목적 : 열성경련은 6세 이하 소아와 2-5%에서 경험하는 비교적 흔한 질환이다. 열성경련을 경험한 소아의 일부는 나중에 비열성경련성질환과 간질로 발전한다. 열성경련 플러스(generalized epilepsy with febrile seizure plus, GEFS+)는 열성경련과 다양한 정도의 전신발작 등 이질적인 표현형을 가진 중요한 유전학적간질증후군이다. 전압관문나트륨채널 아형(voltage-gated sodium, channel subunit) 유전자인 SCN1A의 돌연변이는 열성경련 플러스(GEFS+)를 보이는 상염색체우성 전신간질과 중증 근간대성 간질을 보이는 영아의 열성경련과 관련이 있는 것으로 알려지고 있다. 저자들은 GEFS+와 열성경련으로 진단받은 환아를 대상으로 SCN1A 유전자의 다형성을 알아보기 위하여 본 연구를 시행하였다. 방법 : 가톨릭대학교 의정부성모병원 및 성모자애병원 소아과에서 GEFS+로 진단받은 환아 22명과 열성경련 환아 62명을 대상으로 하여 SCN1A 유전자의 돌연변이를 분석하였다. SCN1A 유전자 exon 9의 증폭은 primer쌍(Foward GGAGGGTGAGACGCTGACTC, Reverse CACCTGGAGCTCCCCAGCTG)을 가지고 touchdown PCR 방법을 수행하였으며 DHPLC를 이용하여 exon 9의 1212에서 SNP(G/A)을 확인하였다. 이후 DHPLC에 의하여 분석된 각 유형에 대하여 염기서열법을 시행하였다. 결과 : 두 가족을 포함한 대상 총 84명 중 GEFS+ 환아군은 22명, 열성경련 환아군은 62명이었다. 열성경련의 형태는 GEFS+ 환아군에서는 단순열성경련 5명, 복합열성경련 17명, 열성경련 환아군에서는 단순열성 49명, 복합열성경련 13명이었다. 열성경련 환아군에서 간질이나 열성경련의 가족력이 있었던 환아는 43.5%이었다. 연령 분포를 보면 평균연령은 GEFS+ 환아군에서 9.1세였으며 12개월에서 33개월 미만 22.74%, 36개월 이상 7세 미만이 18.2%, 7세 이상이 59.1%이었고, 열성경련 환아군에서 2.4세이었으며 12개월 미만 11.3%, 12개월에서 36개월 미만 46.8%, 36개월 이상 7세 미만이 41.9%이었다. 남녀비는 GEFS+ 환아군에서 1.75:1이며 열성경련 환아군에서 1.82:1이었다. SCN1A exon 9의 돌연변이 검사상 exon 9의 1212의 위치에 SNP(G/A)은 84명 중 11명에서 발견되었고 intron부분에서 SNP(G/A)는 84명 중 52명에서 발견되었다. 동종접합유전자형(G/G)에서 intron A/A는 73명 증 22명에서 intron G/G는 5명에서 발견되었다. 이중 이미 보고된 exon 9의 1212에서 돌연변이(1212 G/A intron G/G)는 84명 중 5명이었다. GEFS+와 열성경련 환아에서 1212 G/G intron A/A 또는 G/G, 1212 G/G intron G/A, 1212 G/A intron G/A, 이미 보고된 1212 G/A의 단일염기다형성 빈도에는 통계학적으로 유의한 차가 없었다. 결론 : 비록 GEFS+환아와 열성경련 환아에서 SCN1A유전자의 exon9 다형성이 현저한 차이가 없는 것으로 나왔지만 임상적 인자를 고려한 광범위한 연구가 필요하다 Purpose : Febrile seizures affect 2-5% of all children younger than 6 years old. A small proportion of children with febrile seizures later develop epilepsy. Muations in the voltage-gated sodium channel subunit gene SCN1A have been associated with febrile seizures(FSs) in autosomal dominant generalized epilepsy with febrile seizures plus (GEFS +) families and severe myoclonic epilepsy of infancy. The present study assessed the role of SCN1A in familial typical FSs. Methods: 22 GEFS+ and 62 FSs were selected throughout a collaborative study of Catholic Child Neurology Research Group. The exon 9 region of SCN1A was screened by DHPLC. DNA fragments showing variant chromatograms were subsequently sequenced. Results: A total 84 individuals(22 GEFS+ and 62 FSs) was screened for mutations. Among 22 GEFS+ and 62 FSs patients, five and forty nine showed simple FSs, and seventeen and thirteen had complex FSs. 0% and 8.3% were younger than 12 months old, 22.7% and 46.8% were between 12 and 35 months old, 18.2% and 41.9% were between 36 and 83 months old, and 59.1% and 0% were older than 84 months old. The ratios of male to female were 1.75: 1 and 1.82: 1. Mutational analysis detected no mutation of SCN1A. Mutational analysis detected eleven silent exonic polymorphisms at G1212A in exon 9 and forty two polymorphisms on intron 9, and 23 intron A/As in 73 homozygote samples. There were no significant differences in allelic frequencies(G/G intron A/A or G/G, G/G intron G/A, G/A intron G/A, reported G/A) of G1212A in SCN1A-exon 9 between the patients with GEFS+ and FSs(31.8% vs. 32.3%, 54.5% vs. 54.8%, 9% vs. 6.5%, 4.5% vs. 6.5%). Conclusion : Although our study demonstrated that SCN1A is not frequently involved in GEFS+ and FSs, further systemic research would be necessary.