미국 지방정부 재정파산의 원인 분석 -파산승인 도시를 중심으로-

임재영(林栽永) 한국지방자치학회 2019 韓國地方自治學會報 Vol.31 No.2

최근의 경기침체로 인한 여러 지방정부의 재정부실 문제로 지방파산제에 대한 대중의 관심이 높아졌다. 박근혜 정부 또한 지방파산제 도입을 고려하면서 정치권의 관심 또한 높아졌다. 이에 맞춰 지방파산제를 둘러싼 쟁점을 논의하고자 하는 학계의 다양한 시도도 전개되었다. 특히 미국의 지방파산제를 이해하려는 노력이 많았고, 따라서 주로 제도의 역사와 절차에 주목했다. 이러한 노력에도 불구하고, 아직까지 왜 미국의 일부 지방정부가 재정파산을 했는지에 대한 체계적인 학술적 논의는 진행되지 않았다. 본 논문은 대공황을 기점으로 2008년에서 2017년 사이 재정파산한 미국의 지방정부 사례를 살펴보고, 나아가 파산원인을 도출하였다. 이는 향후 파산제 도입 시 고려되어야 할 사항을 사전에 점검하고, 나아가 한국의 적용 가능성을 파악하는 데 유용한 시사점을 제공할 것이다. 또한 한국정부에서 파산제를 도입하지 않더라도, 지방 재정위기의 원인을 파악하는데 용이할 것이며, 이는 궁극적으로 지방경쟁력을 강화하는데 기여할 것이다. The Great Recession reawakened the public"s interest in fiscal distress of local governments and local bankruptcy. The central government in Korea also tried to introduce local bankruptcy in Korea. Several studies have explored issues surrounding local bankruptcy, In particular, they focused mainly on American local bankruptcy, its history, and procedures. Still, there are few studies examining what causes some local governments to declare bankruptcy, based on several cases. This articles examines American local governments that have had court-approved bankruptcy between 2008 and 2017, with the exception to Orange County having unique causes of bankruptcy. In doing so, the study will help policymakers further their understanding of local bankruptcy as an institution. Even if Korea may not adopt the system, the study"s findings will be still beneficial for those that want to avoid fiscal malpractices and improve their fiscal shape. Ultimately, the study will offer lessons for local governments in their pursuit of strengthening competitiveness.

공공봉사동기와 직무성과: 조직구조의 조절효과를 중심으로

임재영(林栽永),문국경(文國景) 한국정부학회 2019 한국행정논집 Vol.31 No.2

공직봉사동기에 대한 연구가 행정학계를 중심으로 최근 활발히 전개되고 있다. 특히 사적부문과 같이 금전적 인센티브 제공이 쉽지 않은 공적 부문에서 조직성과를 향상할 수 있는 대안으로 공직봉사동기가 학문적 주목을 받고 있다. 다양한 선행연구에서 이미 공공봉사동기가 직무성과에 긍정적 영향을 끼치는 것으로 나타났다. 하지만 공공봉사동기와 직무성과 관련, 조직구조의 조절효과를 실증하는 연구는 여태껏 많지 않다. 본 연구는 ‘자기결정성’ 이론을 근거로, 조직구조의 특성인 집권화와 공식화가 직무성과에 미치는 공공봉사동기의 영향력을 검증하였다. 분석 결과 선행연구와 같이 공공봉사동기가 직무성과에 긍정적 영향을 미쳤다. 또한, 집권화와 공식화도 직무성과와 정(+)의 관계를 맺는 것으로 나타났다. 다만 집권화와 공식화가 공공봉사동기를 조절하는 것으로 검증되어, 지나친 공식화와 집권화 정도가 조직구성원의 공공봉사동기를 저해하는 것으로 드러났다. 연구결과는 공무원에게 어느 정도의 재량권을 부여하고, 직무의 지나친 절차와 공식화는 피해야함을 시사한다. Over the last three decades, many scholars have explored public service motivation as well as its impact on diverse performance-related variables. As public organizations are increasingly under pressure to improve their performance, public service motivation has emerged as a useful concept for performance improvement in the public sector. Still, few studies have examined moderating effects of organizational structure on the relationship between public service motivation and job performance. Employing self-determination theory, we empirically examined such effects. Our results show that public service motivation is still positively associated with job performance. On the other hand, centralization and formalization, as characteristics of organizational structure, also positively influence job performance. However, centralization and formalization are revealed to moderate the relationship between public service motivation and job performance. Our study offers crucial lessons for leaders intent on improving public organizations: leaders need to increase employee"s discretions and avoid an extreme degree of centralization and formalization that would be detrimental to their organizations.

FEM 기법을 이용한 연소기 내 열음향 해석

임재영(Jeayoung Im),김지환(Jihwan Kim),김성구(Seongku Kim),김대식(Daesik Kim) 대한기계학회 2014 대한기계학회 춘추학술대회 Vol.2014 No.5

수동형 로봇팔을 이용한 뇌수술 적용에 관한 연구

임재영(J.Y.Lim),김준호(J.H.Kim),김정하(J.H.Kim),이동준(D.J.Lee),이정교(J.K.Lee) 제어로봇시스템학회 1999 제어로봇시스템학회 합동학술대회 논문집 Vol.1999 No.3

연령과 성별이 한국 노인의 신체 기능과 삶의 질에 미치는 영향

임재영,김병희,박준혁,이석범,백남종,김기웅 대한재활의학회 2007 Annals of Rehabilitation Medicine Vol.31 No.4

Objective: To investigate the physical function of Korean elderly by age and gender and to assess the impact of declined physical function on their quality of life. Method: The Korean Longitudinal Study on Health and Aging (KLoSHA) is designed as a populationbased prospective cohort study on health and aging of Korean elderly aged 65 years and over. In one city among the central metropolitan area for one year, 1,000 subjects includeing a simple random sample and an oldest-old subpopulation participated in baseline study. All subjects are older than 65 years (76.3±14.8, 65∼98 years). We surveyed their general characteristics and symptoms related physical function and examined physical function, functional disabilities, balance function and quality of life with standardized assessment tools. Results: The strengths of quadriceps were preserved over the functional level, but BMI was significantly reduced according to age irrespective of sex. Physical function and quality of life were consistently decreased according to age in female elderly, especially over 80 years. On the contrary, male elderly under 85 years preserved their physical function. In 85∼89 year group, they showed the remarkable disabilities related to musculoskeletal conditions or pain and decrease of balance. Elderly people had greater disabilities and lesser confidence for balance, lower quality of life irrespective of sex. Conclusion:Significant gender differences in Korean elderly were found in the patterns of functional decline. Physical dysfunctions and disabilities are main factors lowering quality of life.

소아 위생검 조직절편을 이용한 H . pylori 감염 진단에 있어서 PCR 적용의 한계

임재영,고경혁,조명제,김윤옥,오영균,박철근,백승철,이우곤,이광호,우향옥,최명범,조윤경,정양숙,박찬후,윤희상,맹국영 대한소화기학회 1998 대한소화기학회지 Vol.31 No.1

Background/Aims: We tried to evaluate the clinical usefulness of the PCR for the diagnosis of H. pylori infection in children and to identify the possible false positive results by the PCR due to remaining H. pylori in the working channel of an endoscope or in the biopsy forceps. Methods: Forty seven urease test samples with three gastric biopsy specimens, 6 collections of 15 ml flushing distilled water after the end of working channel disinfection, 11 15 ml-distilled-water batches as the negative controls, and one H. pylori positive paraffin block as the positive control were collected at the Gyeongsang National University Hospital. The Hel-2 primer set (GTGTGCGGGCTTACAAGGAT, CGTTAGCGTTCATCACACTC) and a 34 cycle amplification were used Results: All of the seventeen specimens of urease tested positive within 6 hours and the ten specimens of urease also tested positive within 48 hours were PCR positive. Eighteen of the 20 specimens of urease tested negative and were also PCR positive. Three of the 6 specimens of 15 ml flushing distilled water were found to be PCR positive. All the negative controls were PCR negative and the one positive control was PCR positive. Conclusions: The clinical usefulness of PCR using gastric biopsy specimens in children was limited due to the possible dead or live H. pylori remaining in the biopsy channel.

영아에서 Helicobacter pylori 감염에 대한 항체반응

임재영,고경혁,조명제,김은아,김윤옥,윤희상,백승철,이우곤,이광호,우향옥,박찬후,정양숙 대한소화기학회 2000 대한소화기학회지 Vol.35 No.6

Background/Aims: The early stage of Helicobacter pylori (H. pylori) infection may show only anti-H. pylori IgM antibody response in young infants. We tried to find out the antigens of H. pylori which stimulate antibody response during the early stage of infection using IgM, IgA, and IgG immunoblot analyses. Methods: Sera of 48 infants were collected at birth and 7 months of age under the permission of parents and sera of 17 infants were also collected at 3 months and 9 months after birth. For those sera, IgM, IgA, and IgG immunoblotting were performed. Results: At the first study, seventeen of 48 (35.4%) infants show 120 kDa band on IgM or IgA immunoblot at 7 months of age. Four infants showed 120 kDa band on IgM immunoblot but not on IgA immunoblot. They were assumed to be infected very recently. At the second study, 2 of 17 showed strong IgM immune response to H. pylori at 3 months of age. The 120, 61, 60, 56, 54, 35, 29, 25, 18 kDa bands were recognized on IgM immunoblot in both studies. Conclusions: At 7 months of age, 35.4 % of infants were infected with H. pylori. Antigens of H. pylori which stimulate antibody response during the early stage of human infection were 120, 61, 60, 56, 54, 47, 29, 25, 18 kDa.

실제적인 환경보전이 필요

임재영 한국환경기술인연합회 1988 환경기술인 Vol.25 No.-

불평등과 행복: Sen의 역량이론의 관점에서 본 불평등의 작동 메커니즘

임재영,구교준,최슬기 서울대학교 한국행정연구소 2016 行政論叢 Vol.54 No.3

Recent studies have considered inequality as one of the most important determinants of happiness. This study examines the mediating effects of inequality on happiness based on the capability perspective introduced by Armatya Sen. Capability is defined as “what people are able to do or to be,” which can be well-aligned with inequality. The results show that as the level of inequality increases, income plays a more important role as a determinant of happiness. On the other hand, income slowly loses its importance as a determinant of happiness as the level of social mobility increases. These results imply that sustainable improvement of overall psychological well-being demands policy efforts to reduce inequality in a society. 많은 기존 연구들이 불평등을 행복의 중요한 결정요인으로 다루고 있다. 그러나 어떤 메커니즘을 통해 불평등이 행복에 영향을 끼치는지에 대한 논의는 충분히 이루어지지 않고 있다. 본 연구는 소득의 한계효과에 영향을 미치는 조절변수로서 불평등의 작동 메커니즘에 대한 설명을 Sen의 역량이론과 연결시켜 시도한다. Sen의 역량 개념을 개인이 가치를 두고 있는 행위나 상태를 얼마나 자유롭게 추구하고 달성할 수 있는지라고 정의한다면, 계층 이동이 어려운 구조적 불평등은 바로 역량이론에서 강조하는 개인이 각자의 가치를 자유롭게 추구할 수 있는 환경이 결여되어 있음을 의미한다고 볼 수 있기 때문이다. 분석결과에 따르면 우선 한 사회의 불평등 정도가 높아질수록 소득의 중요성이 커지는 현상이 관찰되었다. 또한 개인의 계층 이동 가능성이 높이 평가되는 평등한 사회일수록 행복 결정요인으로서 소득의 중요성이 줄어드는 현상이 관찰되었다. 본 연구의 결과는 정책적인 측면에서 매우 중요한 함의를 가진다. 역량 중심의 접근은 소득과 같은 삶의 상대적 조건의 영향을 감소시켜 보다 지속가능한 행복이 가능하게 해 준다. 불평등이 삶의 역량 수준을 보여주는 좋은 지표라고 한다면, 개인 간, 계층 간 불평등의 해소를 위한 정책적 노력이 사회 전반적으로 지속가능한 행복 수준의 제고로 이어질 수 있을 것이다.

The Effect of Doctor’s Payment Method on Patient’s Medical Care Use: Revisit of the Patient’s Asymmetric Information Problem

임재영,조창익 한국개발연구원 2011 KDI Journal of Economic Policy (KDI JEP) Vol.33 No.1

Although the patient’s problem with access to health information has been improved due to rapidly developing information technologies, such as the internet, some patients still do not have enough ability to understand, interpret, and analyze the health information. Given this view on the patient’s asymmetric information problem, if a doctor provides sufficient effort to help patients understand and interpret medical information, the efficiency of patient’s medical care use could be improved. This paper shows firstly that the patient’s inefficient use of medical care originates from his information problems, such as the misperception of the effectiveness of medical care and secondly suggests that if the doctor makes sufficient effort to correct patient’s information problems, the inefficiency can be ameliorated. This paper also suggests the manipulation of a doctor’s payment method can lead a doctor to provide optimal level of efforts which can in turn lead patients to use the optimal level of medical care. With an optimal level of effort, a doctor can more easily achieve a patient’s compliance with the newly recommended amount of medical care.