http://chineseinput.net/에서 pinyin(병음)방식으로 중국어를 변환할 수 있습니다.
변환된 중국어를 복사하여 사용하시면 됩니다.
- 中文 을 입력하시려면 zhongwen을 입력하시고 space를누르시면됩니다.
- 北京 을 입력하시려면 beijing을 입력하시고 space를 누르시면 됩니다.
RISS 인기검색어
- 검색키워드
- 저자 : 이상경 ( Sang Kyeong Lee ) (검색결과 51 건)
- 무료
- 기관 내 무료
- 유료
-
신경회로망을 이용한 4차원 방사선치료에서의 조사 표적 움직임 예측
이상경,김용남,박경란,정경근,이창걸,이익재,성진실,최원훈,정윤선,박성호,Lee, Sang-Kyung,Kim, Yong-Nam,Park, Kyung-Ran,Jeong, Kyeong-Keun,Lee, Chang-Geol,Lee, Ik-Jae,Seong, Jin-Sil,Choi, Won-Hoon,Chung, Yoon-Sun,Park, Sung-Ho 한국의학물리학회 2009 의학물리 Vol.20 No.3
Studies on target motion in 4-dimensional radiotherapy are being world-widely conducted to enhance treatment record and protection of normal organs. Prediction of tumor motion might be very useful and/or essential for especially free-breathing system during radiation delivery such as respiratory gating system and tumor tracking system. Neural network is powerful to express a time series with nonlinearity because its prediction algorithm is not governed by statistic formula but finds a rule of data expression. This study intended to assess applicability of neural network method to predict tumor motion in 4-dimensional radiotherapy. Scaled Conjugate Gradient algorithm was employed as a learning algorithm. Considering reparation data for 10 patients, prediction by the neural network algorithms was compared with the measurement by the real-time position management (RPM) system. The results showed that the neural network algorithm has the excellent accuracy of maximum absolute error smaller than 3 mm, except for the cases in which the maximum amplitude of respiration is over the range of respiration used in the learning process of neural network. It indicates the insufficient learning of the neural network for extrapolation. The problem could be solved by acquiring a full range of respiration before learning procedure. Further works are programmed to verify a feasibility of practical application for 4-dimensional treatment system, including prediction performance according to various system latency and irregular patterns of respiration.
-
부분 강박된 백서에서 클로자핀에 의해 유발된 간대성 근경련에 대한 단가아민계 작용 약물들의 영향
이상경,김현,김선희,박철균,윤성환,김영훈,Lee, Sang-Kyeong,Kim, Hyun,Kim, Sun-Hee,Park, Cheol-Gyoon,Yoon, Seong-Hwan,Kim, Young-Hoon 대한생물정신의학회 1999 생물정신의학 Vol.6 No.1
This study was performed to investigate the mechanism of the clozapine-induced seizures in partially restrained rats by concomitant treatment with drugs affecting monoaminergic systems. Partially restrained rats treated with acute single doses of 10mg/kg clozapine exhibited myoclonic jerks (MJs). Drugs affecting the monoaminergic systems, including 2mg/kg haloperidol, 5mg/kg propranolol, 2mg/kg ritanserin, 20mg/kg fluoxetine, and 20mg/kg imipramine, were concomitantly treated with clozapine to observe the effects of these drugs on the MJs. The drugs were given intraperitoneally either as acute single doses(haloperidol, propranolol, ritanserin, and fluoxetine) or as chronic doses for 21days(haloperidol, imipramine, ritanserin, and fluoxetine). The effects of the concomitant treatment of other drugs on the clozapine-induced MJs were evaluated by comparison of the total numbers of the MJs between the clozapine-treated and concomitantly treated groups. The results were as follows. 1) Concomitant treatment with acute single doses of haloperidol, propranolol, and fluoxetine reduced the total numbers of the clozapine-induced MJs, while concomitant treatment with ritanserin did not. 2) Concomitant treatment with chronic doses of imipramine and ritanserin increased the total numbers of the MJs, while concomitant treatment with fluoxetine reduced them. Concomitant chronic treatment with haloperidol did not affect the numbers of the MJs. These results suggest that dopamine and serotonin, not noradrenalin may be involved in the clozapine-induced MJs in partially restrained rats. Future research needs to study the function of each subtype of monoaminergic receptors on the mechanism of the clozapine-induced seizure.
-
-
U-Eco City 산업 재분류 및 지역경제파급효과 분석
이상경(Lee, Sang-Kyeong),이우종(Lee, Woo-Jong),오영기(Oh, Young-Ki),박종기(Park, Jong-Ki) 한국지역개발학회 2010 韓國地域開發學會誌 Vol.22 No.2
The purpose of this paper is to reclassify industries and analyze regional economic impacts by the ubiquitous and ecological city(U-Eco City) construction. U-Eco City is research concept and thus Sejong City, Chungnam-do and Gwanggyo new town, Gyeonggi-do being similar to it are chosen for case studies. First of all, we classify basic section items of the 404 input-output table of Bank of Korea by analysing the results of U-Eco City services, technologies and scenarios. And then reclassify U-Eco City industry into three hierarchical groups. We make a input coefficient table and calculate output multipliers, value-added multipliers, employment multipliers, indexes of the power dispersion and indexes of the sensitivity dispersion. This paper is the first paper assigned U-Eco City services and technologies to the input-output table of industrial classification and the result is to be a help for choice of U-Eco City services for the test-bed.
-
-
-
-
-
한국인 인슐린 비의존성 당뇨병환자에서 미토콘드리아 유전자 3243 위치의 점돌연변이
이상경(Sang Kyeong Lee),송종훈(Jong Hoon Song),우정택(Jung Taek Woo),김성운(Sung Woon Kim),양인명(In Moon Yang),김진우(Jin Woo Kim),김영설(Young Seol Kim),최영길(Young Kil Choi) 대한내과학회 1996 대한내과학회지 Vol.51 No.3
Objectives: It is well-known that inheritant factors contribute to the development of noninsulin-dependent diabetes(NIDDM). Several candidate genes, including genes for insulin, the insulin receptor, glucokinase and facilitative glucose transporters, have been examined for their involvement in the pathogenesis of NIDDM. Recently it is of interest to focus to relation of mutations in the mitochondrial gene and maternally inherited diabetes and deafness world wide. But in Korea, a few studies have been repirted about the mitochondrial gene mutation in patients with diabetes and so, as a first step of the study of mitchondrial DNA(mtDNA) mutation, we screened 500 NIDDM patients to know the prevalency of A to G transition at nucleotide pair 3243 of mitochondrial DNA tRNALeu(UUR) gene. Methods: Genomic DNA was extracted from the peripheral leukocytes of the patients who diagnosed as NIDDM during the period from march 1993 to december 1994. The mtDNA fragment surrounding the nucleotide pair 3243 site was amplified by polimerase chain reaction using sense primer 5'- AGGACAAGAGAAATAAGGCC(np 3130-3149) and antisense primer 5'-CACGTTGGGGTTCTTGCGTA (np 3404-3423). These fragments were digested with restriction endonuclease Apa I, and subjected to 1.5% agarose gel electrophoresis Results: No digested mtDNA band was found. In other words, Any A to G transition at np 3243 of the mitchondrial gene was not identified in 500 unrelated NIDDM patients screened. Conclusion: A subtype of diabetes mellitus associated with a mitochandrial tRNALeu(UUR) gene mutation seems to be very rare in Korea.
-
DBpia연관 검색어 추천
이 검색어로 많이 본 자료
활용도 높은 자료
