http://chineseinput.net/에서 pinyin(병음)방식으로 중국어를 변환할 수 있습니다.
변환된 중국어를 복사하여 사용하시면 됩니다.
Jae Hyuck Yang,Youn Young Jang,Kwon Jung,Mi Kyeong Ko,Mi Sun Jang,Eun Byul Kook,Chae Kwang Lim,Won Bong Lim,Jin Soo Park,Ok Joon Kim,Hong Ran Choi 대한구강악안면병리학회 2005 대한구강악안면병리학회지 Vol.29 No.5
The purpose 01' pl'esent study was to examine the molecular events in apoptosis by CoCl2, mimicking hypoxic cond ition and recovering effects by LED ir l'adiation on Human SH-SY5Y neuroblastoma cells The SOUl'ce 0 1' light for ir l'adiation was a continuous-wave LED emitting at a wavelenl양h of 590 nm, and manufactured that ene rgy density was 5 mW!cm2 on sample surface, After ir l'adiation, cell viabi lity was measured with BrdU , cell morphol ogy was examined with Diff- Quik staining, cell signaling was monitored with various apoptosis-related molecules using RNase Pl'otection Assay(RPA) , W11en treated with CoC12, apoptotic induction was found in the SH-SY5Y cells in a concentration-dependent and time-dependent manner , Diff-Quik s taining was revealed that DNA fragmentation re presented apoptosis was examined in CoC12-tl'eated group, Moreover, RPA assay of SH-SY5Y cclls lIs ing val'iolls apoptosis-related molecllles showed that the apoptotic cell population was mcreased J-loweve. there was sorne signifïcant change in LED irradiatied cells aftel' treatement of CoC12 The main mechanism for Lhese a poptosis appearecl to be mito c hondriεt - m ecliated pathway, such as cytochrome- c‘ caspase-9, caspase-3, pro-apototic protein ßax, anti-apototic protein Bcl-2, and death receptor• mediated pathway, such as Fas, cas pase- 8, a ncl TNFRl These results demonstrate that CoCI2 induce apoptosis in SH-SY5Y via different dual apop tosis pathway through death receptor pathway as well as mitochondria- dependent pathway and LED irradiation can recl llces the CoCl2-induced apoptosis by blocking their internal signaling pathway
Lim, Chae Yoon,Chang, Jae Hyuck,Lee, Won Sun,Lee, Kang Min,Yoon, Young Chul,Kim, Jeana,Park, Il Young Elsevier 2018 Pancreatology Vol.18 No.8
<P><B>Abstract</B></P> <P><B>Background</B></P> <P> <I>/Objective</I>: The conventional models currently used to evaluate various anti-tumor therapeutic agents are not sufficient for representing human pancreatic ductal adenocarcinoma (PDA), which has a unique tumor microenvironment. We aimed to produce an organotypic slice culture model from human PDA that resembles the <I>in vivo</I> situation and to evaluate the responses of PDA slices to established cytotoxic drugs.</P> <P><B>Methods</B></P> <P>PDA tissues were obtained from 10 patients who underwent pancreatic resection. The tissues were sliced by a vibratome, and the tumor slices were then cultured. The viability of tumor slices during slice culture was evaluated using H&E and immunohistochemical staining, and stromal cells were demonstrated. The effects of cytotoxic drugs on PDA cell lines and slices were analyzed.</P> <P><B>Results</B></P> <P>Tumor slices maintained their surface areas and tissue viability for at least five days during culture. Preserved proliferation and apoptosis in tumor slices were observed by the expression of Ki-67 and cleaved caspase-3. Stromal cells including macrophages (CD68<SUP>+</SUP> and CD163<SUP>+</SUP>), T cells (CD3<SUP>+</SUP>, CD8<SUP>+</SUP>, and FOXP3<SUP>+</SUP>), and myeloid cells (CD11b<SUP>+</SUP>) were present throughout the culture period. Staurosporine, gemcitabine, and cisplatin treatment of PDA cell lines and tumor slices exerted proportional cytotoxic effects in terms of MTT viability, tumor cell number, and Ki-67 and cleaved caspase-3 expression.</P> <P><B>Conclusions</B></P> <P>Organotypic human PDA slice cultures preserved their viability and tumor microenvironment for at least five days during slice culture. PDA slice culture appears to be a feasible preclinical test model to assess the response to anti-tumor agents.</P>
Lim Chae Yoon,Chang Jae Hyuck,Lee Won Sun,Kim Jeana,Park Il Young 거트앤리버 소화기연관학회협의회 2022 Gut and Liver Vol.16 No.4
Background/Aims: CD40 agonists are thought to generate antitumor effects on pancreatic cancer via macrophages and T cells. We aimed to investigate the role of CD40 agonists in the differentiation of macrophages and treatment of human pancreatic adenocarcinoma. Methods: Immunohistochemistry was performed on paraffin-embedded surgical blocks from patients with pancreatic cancers to evaluate macrophage phenotypes and their relationship with survival. The effects of CD40 agonists on macrophage phenotypes and human pancreatic cancer were evaluated utilizing cell cocultures and organotypic slice cultures. Results: CD163+ (predominant in M2 macrophages) and FOXP3+ (predominant in regulatory T cells) expression levels in the tumors were significantly lower in patients with stage IB pancreatic cancer than in those with stage II or III disease (p=0.002 and p=0.003, respectively). Patients with high CD163+ expression had shorter overall survival than those with low CD163+ expression (p=0.002). In vitro treatment of THP-1 macrophages with a CD40 agonist led to an increase in HLA-DR+ (predominant in M1 macrophages) and a decrease in CD163+ expression in THP-1 cells. Cell cocultures showed that CD40 agonists facilitate the suppression of PANC-1 human pancreatic cancer cells by THP-1 macrophages. Organotypic slice cultures showed that CD40 agonists alter the pancreatic cancer microenvironment by shifting the macrophage phenotype toward M1 (increase HLA-DR+ and decrease CD163+ expression), decreasing the abundance of regulatory T cells, and increasing tumor cell apoptosis. Conclusions: CD163 is related to advanced human pancreatic cancer stages and shorter overall survival. CD40 agonists alter macrophage phenotype polarization to favor the M1 phenotype and suppress human pancreatic cancer.
10 년간 경상의대 의학과 학생의 A 형 간염 항체 양성률 변화와 경상의대 소아과 근무 의료인의 항체 양성률
임재영,고경혁,조명제,이시은,조중현,윤희상,백승철,이우곤,이광호,우향옥,조윤경,박찬후,정양숙,이수진 대한소화기학회 1999 대한소화기학회지 Vol.33 No.4
Background/Aims: Korean population has been suggested to be minimally exposed to hepatitis A virus (HAV) for recent 20 years. Therefore, hepatitis A epidemics may occur among medical students and medical personnels who care the asymptomatic patients with hepatitis A. We investigated the changes in anti-HAV IgG positive rate among the medical students for 10 years and the curren anti-HAV IgG positive rate among the medical personnels in Chinju. Methods: Serum anti-HAV IgG was measured using the commercially available HAVAB radioimmunoassay kit. The sera had been collected from 780 sophomore medical students during 1988-1997 and from 95 pediatric medical personnels at the Gyeongsang National University Hospital in December, 1997. Results: The anti-HAV IgG positive rate of the sophomore medical students was 87.5% in 1988, 86.7% in 1989 83.8% in 1990, 75% in 1991, 85% in 1992, 70% in 1993, 56.3% in 1994, 58.8% in 1995, 53.8% in 1996 and 38.8% in 1997. The anti-HAV IgG positive rate among the pediatric medical personnel (mean age ±S.D.; 26.4 ±3.1) was 65.3%. Conclusions: These suggest that the population susceptible to HAV exists among medical students and pediatric medical personnels. Therefore, we should se up the preventive modalities against hepatitis A virus infection among these high risk groups.
소아 위생검 조직절편을 이용한 H . pylori 감염 진단에 있어서 PCR 적용의 한계
임재영,고경혁,조명제,김윤옥,오영균,박철근,백승철,이우곤,이광호,우향옥,최명범,조윤경,정양숙,박찬후,윤희상,맹국영 대한소화기학회 1998 대한소화기학회지 Vol.31 No.1
Background/Aims: We tried to evaluate the clinical usefulness of the PCR for the diagnosis of H. pylori infection in children and to identify the possible false positive results by the PCR due to remaining H. pylori in the working channel of an endoscope or in the biopsy forceps. Methods: Forty seven urease test samples with three gastric biopsy specimens, 6 collections of 15 ml flushing distilled water after the end of working channel disinfection, 11 15 ml-distilled-water batches as the negative controls, and one H. pylori positive paraffin block as the positive control were collected at the Gyeongsang National University Hospital. The Hel-2 primer set (GTGTGCGGGCTTACAAGGAT, CGTTAGCGTTCATCACACTC) and a 34 cycle amplification were used Results: All of the seventeen specimens of urease tested positive within 6 hours and the ten specimens of urease also tested positive within 48 hours were PCR positive. Eighteen of the 20 specimens of urease tested negative and were also PCR positive. Three of the 6 specimens of 15 ml flushing distilled water were found to be PCR positive. All the negative controls were PCR negative and the one positive control was PCR positive. Conclusions: The clinical usefulness of PCR using gastric biopsy specimens in children was limited due to the possible dead or live H. pylori remaining in the biopsy channel.
대유행 인플루엔자(H1N1 2009) 감염과 연관된 폐쇄 세기관지 기질화 폐렴 1예
임민희,허상택,김호철,배인규,김재희,김인숙,김선주,고경혁 대한감염학회 2010 감염과 화학요법 Vol.42 No.2
Several types of influenza-related pneumonia have been reported. Bronchiolitis obliterans organizing pneumonia (BOOP) is a nonspecific lung injury. A 64-yearold man sought care to an emergency room due to breathing difficulties. He was diagnosed with pandemic influenza (H1N1 2009) by the real-time polymerase chain reaction (PCR) and was suspected of concomitant bacterial pneumonia. Therefore he was treated with oseltamivir and broad spectrum antibiotics. The disease progressed rapidly despite treatment, so a corticosteroid was added. The trans-bronchial lung biopsy was consistent with BOOP. Here, we investigated BOOP associated with the pandemic influenza (H1N1 2009) virus that was successfully treated with a combination of antiviral, antibacterial and corticosteroid drugs. Although BOOP associated with influenza is rare, combined disease should be suspected especially when the pneumonia does not response to antiviral agents and antibiotics.
영아에서 Helicobacter pylori 감염에 대한 항체반응
임재영,고경혁,조명제,김은아,김윤옥,윤희상,백승철,이우곤,이광호,우향옥,박찬후,정양숙 대한소화기학회 2000 대한소화기학회지 Vol.35 No.6
Background/Aims: The early stage of Helicobacter pylori (H. pylori) infection may show only anti-H. pylori IgM antibody response in young infants. We tried to find out the antigens of H. pylori which stimulate antibody response during the early stage of infection using IgM, IgA, and IgG immunoblot analyses. Methods: Sera of 48 infants were collected at birth and 7 months of age under the permission of parents and sera of 17 infants were also collected at 3 months and 9 months after birth. For those sera, IgM, IgA, and IgG immunoblotting were performed. Results: At the first study, seventeen of 48 (35.4%) infants show 120 kDa band on IgM or IgA immunoblot at 7 months of age. Four infants showed 120 kDa band on IgM immunoblot but not on IgA immunoblot. They were assumed to be infected very recently. At the second study, 2 of 17 showed strong IgM immune response to H. pylori at 3 months of age. The 120, 61, 60, 56, 54, 35, 29, 25, 18 kDa bands were recognized on IgM immunoblot in both studies. Conclusions: At 7 months of age, 35.4 % of infants were infected with H. pylori. Antigens of H. pylori which stimulate antibody response during the early stage of human infection were 120, 61, 60, 56, 54, 47, 29, 25, 18 kDa.