열성경련 플러스에서 SCN1A-exon 9의 단일염기다형성

노석만(Suk-Man Roh) 엄태훈(Tae-Hun Eom) 김진모(Jinmo Kim) 김영훈(Young-Hoon Kim) 정승연(Seung-Yun Chung) 이인구(In-Goo Lee) 황경태(Kyung-Tai Whang) 이권행(Kweon-Haeng Lee) 대한소아신경학회 2004 대한소아신경학회지 Vol.12 No.1

목적 : 열성경련은 6세 이하 소아와 2-5%에서 경험하는 비교적 흔한 질환이다. 열성경련을 경험한 소아의 일부는 나중에 비열성경련성질환과 간질로 발전한다. 열성경련 플러스(generalized epilepsy with febrile seizure plus, GEFS+)는 열성경련과 다양한 정도의 전신발작 등 이질적인 표현형을 가진 중요한 유전학적간질증후군이다. 전압관문나트륨채널 아형(voltage-gated sodium, channel subunit) 유전자인 SCN1A의 돌연변이는 열성경련 플러스(GEFS+)를 보이는 상염색체우성 전신간질과 중증 근간대성 간질을 보이는 영아의 열성경련과 관련이 있는 것으로 알려지고 있다. 저자들은 GEFS+와 열성경련으로 진단받은 환아를 대상으로 SCN1A 유전자의 다형성을 알아보기 위하여 본 연구를 시행하였다. 방법 : 가톨릭대학교 의정부성모병원 및 성모자애병원 소아과에서 GEFS+로 진단받은 환아 22명과 열성경련 환아 62명을 대상으로 하여 SCN1A 유전자의 돌연변이를 분석하였다. SCN1A 유전자 exon 9의 증폭은 primer쌍(Foward GGAGGGTGAGACGCTGACTC, Reverse CACCTGGAGCTCCCCAGCTG)을 가지고 touchdown PCR 방법을 수행하였으며 DHPLC를 이용하여 exon 9의 1212에서 SNP(G/A)을 확인하였다. 이후 DHPLC에 의하여 분석된 각 유형에 대하여 염기서열법을 시행하였다. 결과 : 두 가족을 포함한 대상 총 84명 중 GEFS+ 환아군은 22명, 열성경련 환아군은 62명이었다. 열성경련의 형태는 GEFS+ 환아군에서는 단순열성경련 5명, 복합열성경련 17명, 열성경련 환아군에서는 단순열성 49명, 복합열성경련 13명이었다. 열성경련 환아군에서 간질이나 열성경련의 가족력이 있었던 환아는 43.5%이었다. 연령 분포를 보면 평균연령은 GEFS+ 환아군에서 9.1세였으며 12개월에서 33개월 미만 22.74%, 36개월 이상 7세 미만이 18.2%, 7세 이상이 59.1%이었고, 열성경련 환아군에서 2.4세이었으며 12개월 미만 11.3%, 12개월에서 36개월 미만 46.8%, 36개월 이상 7세 미만이 41.9%이었다. 남녀비는 GEFS+ 환아군에서 1.75:1이며 열성경련 환아군에서 1.82:1이었다. SCN1A exon 9의 돌연변이 검사상 exon 9의 1212의 위치에 SNP(G/A)은 84명 중 11명에서 발견되었고 intron부분에서 SNP(G/A)는 84명 중 52명에서 발견되었다. 동종접합유전자형(G/G)에서 intron A/A는 73명 증 22명에서 intron G/G는 5명에서 발견되었다. 이중 이미 보고된 exon 9의 1212에서 돌연변이(1212 G/A intron G/G)는 84명 중 5명이었다. GEFS+와 열성경련 환아에서 1212 G/G intron A/A 또는 G/G, 1212 G/G intron G/A, 1212 G/A intron G/A, 이미 보고된 1212 G/A의 단일염기다형성 빈도에는 통계학적으로 유의한 차가 없었다. 결론 : 비록 GEFS+환아와 열성경련 환아에서 SCN1A유전자의 exon9 다형성이 현저한 차이가 없는 것으로 나왔지만 임상적 인자를 고려한 광범위한 연구가 필요하다 Purpose : Febrile seizures affect 2-5% of all children younger than 6 years old. A small proportion of children with febrile seizures later develop epilepsy. Muations in the voltage-gated sodium channel subunit gene SCN1A have been associated with febrile seizures(FSs) in autosomal dominant generalized epilepsy with febrile seizures plus (GEFS +) families and severe myoclonic epilepsy of infancy. The present study assessed the role of SCN1A in familial typical FSs. Methods: 22 GEFS+ and 62 FSs were selected throughout a collaborative study of Catholic Child Neurology Research Group. The exon 9 region of SCN1A was screened by DHPLC. DNA fragments showing variant chromatograms were subsequently sequenced. Results: A total 84 individuals(22 GEFS+ and 62 FSs) was screened for mutations. Among 22 GEFS+ and 62 FSs patients, five and forty nine showed simple FSs, and seventeen and thirteen had complex FSs. 0% and 8.3% were younger than 12 months old, 22.7% and 46.8% were between 12 and 35 months old, 18.2% and 41.9% were between 36 and 83 months old, and 59.1% and 0% were older than 84 months old. The ratios of male to female were 1.75: 1 and 1.82: 1. Mutational analysis detected no mutation of SCN1A. Mutational analysis detected eleven silent exonic polymorphisms at G1212A in exon 9 and forty two polymorphisms on intron 9, and 23 intron A/As in 73 homozygote samples. There were no significant differences in allelic frequencies(G/G intron A/A or G/G, G/G intron G/A, G/A intron G/A, reported G/A) of G1212A in SCN1A-exon 9 between the patients with GEFS+ and FSs(31.8% vs. 32.3%, 54.5% vs. 54.8%, 9% vs. 6.5%, 4.5% vs. 6.5%). Conclusion : Although our study demonstrated that SCN1A is not frequently involved in GEFS+ and FSs, further systemic research would be necessary.

열성경련 플러스에서 SCN1B 유전자의 돌연변이

노영래(Young-Nae Roh),신미영(Mi-Young Shin),김영훈(Young-Hoon Kim),고영선(Young Sun Ko),김진모(Jinmo Kim),김홍태(Hongtae Kim),김흥동(Heung Dong Kim),황경태(Kyung-Tai Whang),이권행(Kweon-Haeng Lee) 대한소아신경학회 2002 대한소아신경학회지 Vol.10 No.2

목 적 : 열성경련은 6세 이하 소아의 2-5%에서 경험하는 비교적 흔한 질환이다. 열성경련을 경험한 소아의 일부는 나중에 비열성경련성질환과 간질로 발전한다. 열성경련플러스(generalized epilepsy with febrile seizure plus, GEFS+)는 열성경련과 다양한 정도의 전신발작 등 이질적은 표현형을 가진 중요한 유전학적간질증후군이다. GEFS+ 관련 유전자는 염색체 19q13.1에 존재하며, voltage-gated sodium channel β1 subunit(SCN1B) 유전자 exon 3내 387 C→G DNA돌연변이와 관련되었다고 보고되었다. 저자들은 단순 열성경련 및 GEFS+로 진단받은 환아를 대상으로 SCN1B 유전자의 돌연변이 여부를 알아보기 위하여 본 연구를 시행하였다. 방 법 : GEFS+로 진단받은 환아 18명과 단순열성경련 환아 13명 등 가족력이 있는 열성경련환아 31명을 대상으로 하여 SCN1B 유전자의 돌연변이를 선별하였다. 5개의 SCN1B exon을 증폭하기 위한 primer쌍은 Neurology Web 사이트에 올려진 Wallace등의 자료에 얻었다. 모든 exon을 PCR로 증폭하였고 증폭된 유전자는 단계적으로 염기서열을 분석하였으며 단일가닥구조다형성(Single-Stranded DNA Conformational Polymor-phism, SSCP) 분석을 8% polyacrylamide gel을 사용하여 수행하였다. 결 과 ; 연령 분포를 보면 10세 미만 24명(77%), 10세에서 14세 미만 3명(10%), 14세 이상 4명(13%)이었다. 남녀비는 0.55였다. GEFS+ 환아의 간질발작 양상으로는 전신 강직-간대발작 14(88%), 근간대발작 1명(6%), 탈력발작 1명(6%)이었다. 뇌파소견ㄴ은 정상 11명(78%), generalized spike wave 5명(28%), diffuse slowing 2명(11%)이었다. 염기서열분석고 SSPC 분석을 통한 본 연구에서는 GEFS+군 2례에서 SCN1B 유전자 exon 3내 DNA 돌연변이를 관찰할 수 있었다. 2례에서 모두 SCN1B 유전자 exon 3내 224 G와 225 C 사이에 염기 C가 추가되어 있는 돌연변이였다. 돌연변이를 나타낸 2례는 다른 가족에서 발생한 경우이다. 결 론 : 저자들은 가족이 다른 두명의 GEFS+ 환아에서 SCN1B 유전자의 새로운 돌연변이를 확인할 수 있었다. Purpose : Febrile seizures affect 2-5% of all children younger than 6 years olf. A small proportion of children with febrile seizures later develop epilepsy. Generalized epilepsy with febrile seizures plus(GEFS+) is an important childhood genetic epilepsy syndrome with heterogeneous phenotypes, including febrile seizures(FS) and generalized epilepsies of variable severity. It was reported that the gene locus for GEFS+ exists in the chromosome 19q13.1, and has relationship with a 387 C→G mutation in the voltage-gated sodium channel β1 subunit(SCN1B) gene. This study is to determine whether there are mutations in children with GEFS+ and FS. Methods : Eighteen GEFS+ and thirteen FS patients were screened for mutations in the sodium channel beta-subunits SCN1B. The primer pairs used to amplify the exons of SCN1B are given in the supplementary data on the Neurology web site. All exons were amplified by PCR and PCR products were subsequently sequenced. Single-stranded conformation polymorphism(SSCP) was carried out using 8% polyacrylamide gel. Results : Twenty four patients(77%) were younger than 10 years old, three(10%) were between 10 and 14 years old, and four(13%) older than 14 years old. The ratio of female to male was 0.55:1.0 In phenotypes of GEFS+, fourteen patients(88%) had generalized tonic-clonic seizures, one patient(6%) myoclonic seizures and one patient(6%) atonic seizures. In EEG findings of GEFS+, eleven(78%) patients had normal findings, five(28%) patients generalized spike waves and two patients(11%) diffuse slowings. In sequencing and SSCP of PCR products, we could observe added C mutations between 224G and 225C of exon 3 in two unrelated patients with GEFS+. Conclusion : We proved the existence of a new mutation of SCN1B in two unrelated patients with GEFS+.

열성경련과 열성경련플러스(GEFS+)에서 인터루킨-1β 촉진자의 다형성

정승연(Seung Yun Chung),박양준(Yang Joon Park),김영훈(Young HOon Kim),이인구(In Goo Lee),황경태(Kyung Tai Whang),이준성(Joon Sung Lee),김혜성(Hye Sung Kim),이권행(Kweon Haeng Lee),임성빈(Sung Vin Yim) 대한소아신경학회 2006 대한소아신경학회지 Vol.14 No.1

목 적: 최근에 IL-1β 유전자 촉진자 부위의 위치 -511(IL1B -511)에서 단일염기다형성이 발견되었다. 그러나 열성경련에서 IL-1β 유전자 촉진자의 다형성 이 관여하는지에 대해서는 상반된 보고가 있다. 본 연구에서는 IL-1β 유전자의 위치 -31과 -511에 촉진자 부위의 기능과 관련이 있는 단일뉴클레오티드 염기 C/T대립 다형성이 열성경련의 감수성과 연관이 있는지 여부를 알기 위하여 단순열성경련, GEFS+ 및 건강한 대조군에서 IL1B-31과 -511 다형성의 빈도를 조사하였다. 방 법: 가톨릭대학교 의정부성모병원 및 성모자애병원 병원 소아과에서 진단받은 열성경련 환아 72명, GEFS+ 환아 23명 및 건강한 대조군 174명, 총 269명을 대상으로 하였다. IL1B -31 C/T 유전형과 IL1B -511 C/T 유전형은 PCR-제한절 편길이다형성으로 결정하였다. 결 과 : IL1B -31 유전자에 대한 유전형 분포와 대립유전자 빈도는 통계학적으로 유의한 차이가 없었다. C동형접합자, C/T이형접합자 및 T동형접합자의 분포는 열성경련 환아군에서 22.2%, 50.0% 및 27.8%이었고, GEFS+ 환아군에서 21.7%, 43.5% 및 34.8%이었으며, 건강한 대조군에서 27.6%, 49.3% 및 24.1%이었다. IL1B -511 유전자에 대한 유전형 분포와 대립유전자 빈도는 통계학적으로 유의한 차이가 없었다. C동형접합자, C/T이형접합자 및 T동형접합자의 분포는 열성경련 환아군에서 23.6%, 47.2% 및 29.2%이었고, GEFS+ 환아군에서 26.1%, 39.1% 및 34.8%이었으며, 건강한 대조군에서 27.6%, 49.3% 및 24.1%이었다. 결 론: 이러한 결과는 IL1B -31과 -511 유전자가 한국인 열성경련의 유력한 유전적 표지는 아니라는 것을 보여주는 것이다. Purpose : Studies gave conflicting results as to the association between febrile seizures(FSs) and IL1B promoter polymorphisms. In the present study, to determine whether or not the function-related two single nucleotide base C/T biallelic polymorphisms in the promoter region at positions -31 and -511 of the IL1B gene are associated with susceptibility to FSs, the frequencies of the polymorphisms were investigated in children with FSs and GEFS+, and normal control subjects. Methods : 72 FSs, 23 GEFS+ and 174 healthy control subjects were selected throughout a collaborative study of Catholic Child Neurology Research Group. IL1B promoter -31 C/T and -511 C/T genotyping was performed by means of PCR-restriction fragment length polymorphism. Results : The distribution of IL1B -31 genotypes and the frequencies of allele in children with FSs and GEFS+, nd healthy control subjects were not significantly different. The distributions of IL1B -31 genotypes(CC, CT, TT) are 22.2%, 50%, and 27.8% in children with FSs, 21.7%, 43.5% and 34.8% in children with GEFS+, and 27.6%, 49.3% and 24.1% in healthy control subjects. The distribution of IL1B -511 genotypes and the frequencies of allele in children with FSs and GEFS+, and healthy control subjects were not significantly different. The distributions of IL1B -511 genotypes(CC, CT, TT) are 23.6%, 47.2%, and 29.2% in children with FSs, 26.1%, 39.1% and 34.8% in children with GEFS+, and 27.6%, 49.3% and 24.1% in healthy control subjects. Concl usi on : Theses data suggest that genomic variations of IL1B promoter might not be one of the susceptibility factors for FSs in the Korean population.

열성경련과 열성경련플러스(GEFS+)에서 GABRG2의 단일염기다형성

조상민(Sang Min Cho),김영훈(Young Hoon Kim),정승연(Seung Yun Chung),이인구(In Goo Lee),황경태(Kyung Tai Whang),이병철(Byung Churl Lee),이권행(Kweon Haeng Lee) 대한소아신경학회 2005 대한소아신경학회지 Vol.13 No.2

목 적 : 열성경련은 불완전한 침투를 보이는 상영색체우성 질환으로 이질적인 표현형을 특징으로 한다. 최근에 열성경련과 특발성 전신간질을 보이는 가계와 소아기의 결신발작과 열성경련이 동반된 가계에서 독립적으로 γ-aminobutyric acid(GABA)receptor γ2 subunit gene(GABRG2)에 돌연변이가 있는 것이 밝혀졌다. 본 연구는 한국의 열성경련 환아와 GEFS+ 환아에서 GABRG2 유전자의 다형성이 질환의 감수성에 미치는 영향을 알아보기 위하여 시도되었다. 방 법 : 가톨릭대학교 의정부성모병원 및 성모자애병원 소아과에서 진단받은 열성경련 환아 66명, GEFS+ 환아 20명 및 건강한 대조군 94명, 총 180명을 대상으로 하였다. GABRG2의 SNP211037은 DHPLC를 이용하여 분석하였다. 이후 DHPLC에서 변이를 보인 DNA조각에 대해서는 염기서열법을 시행하였다. 세 군에서 GABRG2유전자 다형성의 유전형 분포와 대립유전자 빈도를 비교하였다. 결 과 : 열성경련 환아에서 GABRG2(SNP211037)-CC유전자형을 가진 소아의 수는 건강한 대조군에 비하여 통계적으로 의의 있게 많았다. 열성경련 환아에서 GABRG2(SNP211037)-C 대립유전자 빈도가 건강한 대조군에 비하여 통계적으로 의의 있게 높았다. GABRG2(SNP211037)-CC 유전자형을 가진 소아에서 열성경련으로 발전할 수 있는 교차비(odds ratio)는 GABRG2(SNP211037)-TT 유전자형을 가진 소아에 비하여 5.96배 높았다(P<0.001). 반면에 GEFS+환아에서 GABRG2(SNP211037) 유전자 분포는 건강한 대조군과 통계학적으로 의의있는 차이가 없었다. 결 론 : 이러한 결과는 GABRG2의 유전체 변이가 한국의 열성경련에 감수성을 일으키는 인자의 하나가 될 수 있음을 시사하는 것이다. Purpose : Febrile seizures are characterized by a heterogenous phenotype segregating as an autosomal dominant trait with incomplete penetrance. Mutations in GABRG2 gene were identified in two families with generalized epilepsy and febrile seizures plus(GEFS+) and with absence epilepsy and febrile seizures(FSs). The present study assessed the role of GABRG2 gene in FSs and GEFS+ of the Korean population. Methods :66 FSs, 20 GEFS+ and 94 healthy control subjects were selected throughout a collaborative study of Catholic Child Neurology Research Group. The SNP211037 of GABRG2 was screened by DHPLC. DNA fragments showing variant chromatograms were subsequently sequenced. Genotypes and allelic frequencies for GABRG2 gene polymorphism in three groups were compared. Results : The number of individuals with the GABRG2(SNP211037)-C/C genotype in patients with FSs was significantly greater compared with that in healthy control subjects and the GABRG2(SNP211037)-C allele frequency in patients with FSs was significantly higher than that in healthy control subjects. The odds ratio for developing FSs in individuals with the GABRG2(SNP211037)-CC genotype was 5.96 compard with individuals with the GABRG2(SNP211037)-T/T genotype. In contrast, the GABRG2(SNP211037) gene in GEFS+ and control groups was not significantly different. Conclusion : theses data suggest that genomic variations of GABRG2 might be one of the susceptibility factors for FSs in the Korean population.

열성경련 플러스(GEFS+)의 임상적 특성과 신경학적 예후

김은주(Eun Joo Kim),성태정(Tae Jung Sung),신선희(Seon Hee Shin),김성구(Sung Koo Kim),이건희(Kon Hee Lee),윤혜선(Hae Sun Yoon) 대한소아신경학회 2006 대한소아신경학회지 Vol.14 No.2

목 적: 열성경련 플러스란 열성경련이 6세 이후에도 발생하거나 비열성 경련이 동반되는 경우를 말한다. 본 연구에서는 GEFS+의 임상 양상과 뇌파소견, 예후 등을 알아보고 이를 다시 열성경련 시작 연령이 6세 미만인 경우와 6세 이상인 경우로 나누어 그 차이를 알아보고자 하였다. 방 법: 1993년 1월부터 2004년 12월까지 12년동안 한림대학교 강남성심병원 소아과에 입원하여 치료받은 환아 중 열성경련이 6세 이후에도 지속되었던 환아와 비열성경련이 동반된 환아 55명을 대상으로 하여 열성경련의 시작 연령, 성별, 가족력 유무, 경련빈도, 뇌파소견, 신경학적 이상, 발달장애 여부 등을 조사하였다. 결 과: 열성경련의 시작 연령은 평균 3년 9개월이었으며 시작 연령이 6세 미만인 경우가 41례, 6세 이상인 경우가 14례였다. 경련의 가족력이 있는 경우는 총 17례였다. 경련빈도는 평균 4.4회(범위는 1-24회)였으며 열성경련의 횟수는 평균 3.4회(범위 1-24회)였고 비열성경련이 동반된 경우는 모두 31례(56.3%)였으며 비열성경련의 횟수는 평균 1.7회(범위 1-12회)였다. 경련의 양상에서는 열성경련과 비열성경련 모두 전신발작이 가장 많았다. 뇌파검사는 모두 51례(92.7%)에서 시행하였으며 이중 19례(37.3%)에서 이상소견이 있었고 뇌영상 검사를 시행한 경우 는 모두 35례(63.6%)였으며 이중 가장 많이 시행한 검사는 뇌 자기공명영상으로 27례(77.1%)였다. 장기적으로 항경련제를 투여받은 경우는 모두 23례(41.4%)였으며 투여된 항경련제의 종류는 carbamazepine이 14례 (58.3%)로 가장 많았다. 예후에 있어서 신경학적 이상이나 발달장애가 있는 경우는 없었으나 학습 능력 부진이 4례 있었으며 과잉행동 주의력 결핍장애가 3례 있었고 난치성 간질이 3례 있었다. 열성경련의 시작연령에 따른 비교에서는 시작연령이 6세 미만인 경우에서 가족력의 빈도가 더 높은 것으로 나타났으며 경련 빈도, 열성경련의 횟수, 장기적 항경련제 투여가 더 높은 것으로 나타났다. 결 론 : GEFS+의 임상 양상과 뇌파소견 등은 다양하게 나타나며 일부에서 전신 간질의 가능성이 있으며 장기적으로 항경련제가 필요한 경우도 있었으나 신경학적 이상이나 발달장애가 나타나는 경우는 드물었다. 또한 열성경련의 시작 연령이 6세 미만인 경우에 경련의 가족력이 더 많으며 경련 빈도, 열성경련의 횟수, 장기적 항경련제 투여가 더 높은 것으로 나타났다. Purpose : The aim of this study was to characterize the clinical and electroencephalographic features as well as the neurologic outcomes of GEFS+(Genenralized Epilepsy with Febrile Seizures Plus). Methods : We evaluated 55 children with GEFS+ who admitted at the Department of Peditrics, Kangnam Sacred Heart Hospital from 1993 to 2004. We formed them into two groups by age of first febrile seizure; Group A(<6 years) and Group B(≥6 years). We analyzed the clinical features, electroencephalographic findings and the neurological outcomes of the subjects. Results : The mean age of the initial febrile seizures of 55 subjects was 3 years and 9 months. 41 subjects had their initial febrile seizures under 6 years of age while 14 subjects after 6 years of age. 17 subjects had family history of seizures. The mean frequency of seizure is 4.4 times and the types of convulsions were mainly generalized. Nineteen(37.3%) showed abnormal finding on EEG and twenty three(41%) were treated with antiepileptic drug(AED) for long-term prophylaxis. Never the less, there was no subject with abnormalities in the neurological outcomes. The group with the initial seizures occurred under 6 years of age had more family history of seizures, higher frequency of total seizures, febrile seizures, and was administered with AEDs longer than the other group. Conclusion : In our study of GEFS+, the clinical features and the results of the electroencephalograms were various. While there were cases with a need of long term administration of AEDs, few cases of neurological abnormalities or developmental delay were seen. The group of the initial febrile seizures under 6 years of age revealed more family history of seizures, higher frequency of seizures than the other group.

열성경련과 열성경련플러스(GEFS+)에서 Brain-derived neurotrophic factor(BDNF) SNP 6265의 다형성

김상은(Sang Eun Kim),김현규(Hyon Gyu Kim),김영훈(Young Hoon Kim),최병준(Byung Joon Choi),황희승(Hee Seong Hwang),빈중현(Joong Hyun Bin),정승연(Seung Yun Chung),이인구(In Goo Lee) 대한소아신경학회 2008 대한소아신경학회지 Vol.16 No.2

목 적 : 열성경련은 영유아에서 가장 흔한 신경학적 질환 중 하나이나 아직 그 병인은 분명하게 밝혀 지지 않았다. 최근 많은 연구에서 Brain-derived neurotrophic factor(BDNF)의 발현이 신경세포의 흥분을 증가시킨다고 보고되고 있다. 이에 저자들은 BDNF 유전자의 SNP 6265 다형성이 열성경련의 감수성을 예측하는 유용한 표지자인지 여부를 알아보기 위하여 열성경련 환아 및 이전에 연구되지 않았던 열성경련플러스 환아를 대상으로 BDNF 유전자의 SNP 6265 다형성의 빈도를 정상 대조군과 비교, 분석하였다. 방 법: 가톨릭대학교 소아과를 방문한 총 79명을 대상으로 열성경련 환아 30명, 열성경련플러스 환아 19명, 그리고 건강한 정상 대조군 30명의 세 군으로 분류하였으며, BDNF 유전자의 SNP 6265 다형성 여부를 확인하기 위해 각 군간 유전자형 및 대립유전자 빈도를 비교하였다. 결 과 : 세 군의 유전자형 분포는 AA 동형접합자, A/G 이형접합자 및 GG 동형접합자가 열성경련 환아군에서 46.7%, 36.7% 및 16.7%, 열성경련 플러스 환아군에서 26.3%, 47.4% 및 26.3%, 정상 대조군에서는 60.0%, 16.7% 및 23.3%로 가장 흔한 유전자형은 열성경련 환아군과 정상 대조군에서는 A/A 동형 접합자인 반면 열성경련 플러스 환아군에서는 A/G 이형접합자였다. 그리고 BDNF 유전자에 대한 A와 G의 대립유전자 빈도를 분석한 결과는 열성경련 환아군에서 65.0%와 35.0%였고 열성경련플러스 환아군에서 50%와 50%였으며 정상 대조군에서는 68.3%와 31.7%로 열성경련 환아군과 정상 대조군에서 A 대립유전자의 빈도가 더 높았다. 하지만 이러한 유전자형 분포와 대립 유전자 빈도상의 차이는 통계적 의의는 없었다. 결 론: 저자들은 BDNF 유전자의 SNP 6265 다형성이 열성경련 및 열성경련플러스의 병인과 관련이 없으며 이들 질환에 대한 감수성을 예측하는 유용한 표지자가 아님을 확인하였다. Purpose : Febrile seizure(FS) is one of the most common neurological conditions during childhood, but the pathogenesis of FS remains ambiguous. Various studies have shown that brain-derived neurotrophic factor(BDNF) increased neuronal excitability. In this study, to determine whether the polymorphisms of SNP 6265 within the gene encoding BDNF are associated with susceptibility to FS, the frequencies of the polymorphisms were investigated in children with FS and control subjects. In addition, we analyzed the SNP 6265 polymorphisms in Generalized epilepsy with febrile seizures plus (GEFS+) that hasn't been studied as yet in Korea. Methods : A total of 79 children selected throughout a collaborative study of Catholic Child Neurology Research Group were divided into three groups: (1) FS(n=30); (2) GEFS+ (n=19); (3) control subjects(n=30). Genotypes and allelic frequencies for the polymorphisms of SNP 6265 located at nucleotide 196 was analyzed and compared among the groups. Results : In this study, proportions for A homozygote, A/G heterozygote and G homozygote for BDNF were as follows: in FS, 46.7%, 36.7% and 16.7%, in GEFS+, 26.3%, 47.4% and 26.3% and in control subjects, 60.0%, 16.7% and 23.3%. The allele A and G frequencies for BDNF in FS were 65.0% and 35.0%, in GEFS+ were 50% and 50%, and in control subjects were 68.3% and 31.7%. However, these differences in genotype proportions and allele frequencies among three groups were not significant. Conclusion : These results suggest that genomic variations of BDNF might not be the susceptibility factor for FS and GEFS+ in Korean population.

장소전치사 in과 auf의 분포 및 용법상의 차이

구명철 한국독어학회 2011 독어학 Vol.24 No.-

Die Präpositionen in und auf scheinen keine Gemeinsamkeiten zu haben, in dem Sinne, dass in zum Ausdruck inklusiver Relationen gebraucht wird (Butter im Kühlschrank), während auf zum Ausdruck des Kontaktes von oben gebraucht wird (ein Schnitzel auf dem Teller). Es gibt aber Fälle, in denen beide Präpositionen möglich sind (eine Fliege in/auf der Hand, ein Mann in/auf der Post), sodass es sinnvoll sein kann, ihre Verwendungen zu untersuchen und miteinander zu vergleichen. In diesem Aufsatz wird deshalb zuerst je nach dem Grad des Geschlossenseins des Gefäßes und dem Enthaltensein des Objektes die Relationen zwischen dem Gefäß und dem Objekt in einige Typen eingeteilt: ‘Relationen eines Objektes zum geschlossenen Gefäß’, ‘Relationen eines Objektes zum Gefäß ohne Deckel’, ‘Relationen eines teil-enthaltenen Objektes zum Gefäß’, ‘Relationen eines Objektes zum Gefäß ohne Deckel und Seitenwände’. Hierzu werden zwei weitere Relationstypen hinzugefügt: ‘Relationen eines Objektes zum Form-veränderbaren Gefäß’ und ‘Relationen eines Objektes zum funktional interpretierbaren Gefäß’. Nach der Analyse der Verwendungen von in und auf konnten folgende Punkte festgestellt werden: 1) Die Präposition in, die das Enthaltensein als Grundbedeutung hat, kann außer ‘Relationen eines Objektes zum funktional interpretierbaren Gefäß’ alle andere Relationen ausdrücken. Das hat damit zu tun, dass die Restriktionen für das Gefäß, insbesondere für sein Geschlossensein, wenig strenger sind. 2) Bei in wird auch das Enthaltensein des Objektes nicht mehr streng genommen (Blumen in der Vase). 3) Sogar bei Gefäßen ohne Deckel und Seitenwände, bei denen normalerweise auf gebraucht wird, wird in zugelassen: ein Schnitzel im Teller (in der Schweiz) / ein Schnitzel im tiefen Teller. 4) Beim Form-veränderbaren Gefäß wie Hand kann das Gefäß je nach der Situation sowohl als geschlossenes Gefäß (eine Fliege in/*auf der Hand) wie auch als Gefäß mit einem teil-enthaltenen Objekt (ein Schirm in/?auf der Hand) und auch als ein Gefäß ohne Deckel und Seitenwände (ein Butterbrot in/auf der Hand) interpretiert werden. 5) Der Vorzug zwischen in und auf kann verschieden sein: In den Fällen, in denen ein Gebäude als Raum vertanden wird, wird in bevorzugt (Peter fand seine Tasche in > auf der Post); im Gegensatz dazu wird auf bevorzugt, wenn ein Gebäude funktional interpretiert wird (Peter kaufte eine Briefmarke in < auf der Post). Zusammenfassend lässt sich feststellen, dass infolge der Abschwächung der Restriktionen der Verwendungsbereich von in erweitert wird. Der Verwendungsbereich von auf wird erweitert, falls das Gefäß funktional verstanden wird. Die Erweiterungen des Verwendungsbereichs von in und auf resultieren in der Überlappung ihrer Realisierung (ein Schnitzel auf dem/im (tiefen) Teller, Peter kaufte eine Briefmarke ?in/auf der Post).

한국의 위험책임 현황과 입법 논의 : 유럽의 논의와 경험을 바탕으로

김상중 한국민사법학회 2011 民事法學 Vol.57 No.-

Bei der vorliegenden Arbeit geht es aus Anlass des großen Reformvorhabens des koreanischen BGB um die Frage, ob sich eine Vereinheitlichung der verschieden spezialgesetzlichen Vorschriften über die Gefährungshaftung im BGB empfiehlt. Zunächst ist es in Korea sowie in den europäischen Ländern anzuerkennen, dass die moderne Gefährdungshaftung rechtfertigt ist, weil ① die Gesellschaft die besonders hohen Risiken nur um den Preis einer verschuldensunabhängigen Haftung annimmt, und weil ② die Schadenskosten durch die Haftplicht gestreut werden können, dazu weil ③ der Unternehmer der riskanten Aktivität in der Lage ist, ihre Nützlichkeit rational zu beurteilen. Unter dieser Erkenntnis wird es nach wie vor vorgeschlagen, die einzelnen spezialgesetzlichen Gefährungshaftungstatbestände im BGB mit einem allgemeinen Tatbestand zu vereinheiltlichen. Damit wird die unbefriedigende Lage zu vermeiden versucht, die selben Schadensrisiken unabhängig von den spezialgesetzlichen Gefährdungshaftungstatbeständen rechtlich gleich zu regeln. Tortz dieses überlegbaren Vorschlages wird in der vorliegenden Arbeit eine Generalklausel für die Gefährdungshaftung nicht befürwortet, besonders mit den Begründungen, ① der Untrennbarkeit der Gefährdungshaftung von der Verschuldenshaftung, ② der inhaltlichen Verschiedenheit der Gefährdungshaftung je nach den Schadensrisiken, und schliesslich ③ der Unsicherheit eines möglichen Haftungstatbestands“besonderes Risikos”. Es ist doch empfehlenswert, die spezialgesestzlichen Gefährdungstatbestände in Korea mit dem internationalen Niveau nachzuprüfen und gesetzgeberisch zu verbessern.

의료교도소의 필요성과 대책 방안

류여해 한국교정학회 2008 矯正硏究 Vol.- No.40

Die Bedürfnisse von medizinischer Bedhandlung der Gefangenen sind zur Zeit noch großer geworden. Aber momentane Situation ist schlimmer wegen mangelnden Fehlbeträge. Deswegen brauchen wir eine besonderen Plan. Die eigentliche medizinische Mannschaft besteht aus 96 Personen, aber nur 82 Personen sind tätig für Gefangenen. Noch schlimmer ist, das Ministerum für Gesundheitspflege, Wohlfahrt und Familie hat solchen Plan, dass momentane tätigende 76 Öffentliche Ärzte bis zu 72 Personen zu vermindern. Im Jahre 2003 hat das Justizministerium vorgeschlagen, bis zum Jahre 2004 700% mehr die medizinisch tätigende Personen zu vergrößern und speziell-medizinische Institution unter Behörde für Besserung einzurichten. Aber leider nur Paln ist Plan, es ist ja nicht getan. Im Vergleich mit deutscher Situation, insbesondere seit 1968 eingerichtete Stuttgarter Gefängnis-Krankenhaus, das die Gefangenen behandlen lassen hat, ist koreanisches Gefängnis-Krankenhaus schlimmer als deutsches. Viele Gefangenen wünschen die medizinische Behanlung von außen. Aber um eine Gefangenene von außen zu behanlen lassen, braucht mindestens driei bis sechs Hilfeskräfte. Deswegen schlage ich vor folgende : Fern-Behandlung und Einrichtung von privatizierenden Gefängnis-Krankenhaus sind eine bessere Idee, ferner Ausnutzung der Arzt-Lizenz gehaltenen Gefangenen als medizinische Hilfeskräfte ist auch eine denkbare Idee. Und der Arzt als Zivil-Dienst tätig zu machen ist auch ein noch forschendes System. Aber einzige eigentlcidhe Lösungsmethode ist speziell Gefängnis-Krankenhaus mit geschikten Ärzte wie Deutschland und Japan einzurichten. Wenn wir Gefängnis-Krankenhaus und Fern-Behandlung zusammengesetztes System haben, einigermaßen werden die Bedürfnisse von medizinischer Bedhandlung der Gefangenen erfüllen. 수형자들의 의료 진료에 대한 욕구는 점차 더 높아지고 있고 예산은 턱없이 부족해지고 있는 현실에서는 특별한 방안 이 필요하다. 그러나 이들을 진료하는 인력은 96명이 정원으로 책정돼 있으며 그나마 현재는 82명만이 근무하고 있어 매우 부족한 것이 현실이다. 이에 더해 근무하는 공중보건의가 76명이 있으나 곧 배치인력을 72명으로 줄인다는 보건복지가족부의 통보를 받은 상황이다. 2003년 법무부는 2004년 까지 의료 인력을 현재의 700%선으로 확충하고 각 교정청 산하의 특별의료 전담소를 만들겠다는 계획을 내놓은바 있으나 이는 계획에 그치고 말았다. 독일이 1968년부터 Stuttgart 교도소병원에서 병든 죄인들 돌보기 시작 한 것에 비하면 턱없이 열악한 현실이라고 할 수 있다. 현재 많은 수형자들이 외부진료를 희망하고 있다 .그러나 재소자가 한번 외출을 나가려면 계호 인력이 3명이 동원돼야 하며 야간에까지 외출이 이어지면 3명의 추가인력이 붙어 총 6명이 동원돼야 한다. 외부진료는 실질적으로 많은 인력 낭비를 초래한다. 그렇기 때문에 이제는 특별한 방안이 필요하다고 본다. 원격진료와 의료민영교도소를 만들자는 목소리가 나오고 있지만, 또 다른 방법으로는 의사면허증을 가진 수형자를 의료 인력으로 활용하는 것이라고 생각한다. 그리고 일반의들에게 봉사활동의 영역으로 의무적으로 근무하게 하는 것도 장기적으로 볼 때 연구할만한 시스템이라는 생각이 든다. 그러나 근본적인 방안으로는 독일과 일본과 같은 선진국처럼 전문 의료진으로 구성된 의료교도소를 설립하는 것이 우리의 과제이다. 의료교도소와 원격진료를 복합 한다면 어느 정도 수형자의 의료 욕구를 충족 할 수 있을 것이라 기대 된다. 다시 한 번 수형자의 교정처우를 위해 신속하게 의료개선이 필요하다고 본다.

크라취와 킨트호이저의 추상적 위험범론

안수길 한양대학교 법학연구소 2023 법학논총 Vol.40 No.3

추상적 위험범은 법익을 해칠 위험이 전무한 행위에도 형벌을 부과할 위험을 내포하고 있어서 비례원칙・책임원칙에 어긋날 소지가 크다. 그럼에도 추상적 위험범은 여론의 지지를 받는 “공격적인 형사정책을 펴는 사람들”의 “좋은 무기”로 상용되고 있다. 비유하자면, 추상적 위험범은 형법이론에서는 ‘애물’이지만 형사정책에서는 ‘총아’인 것이다. 이 어색한 간극을 해소하려면 추상적 위험범의 레종 데트르(raison d’être)를 탐색할 필요가 있다. 지금까지 그러한 탐색을 수행해 온 학자 대다수는 추상적 위험범이 비례원칙・책임원칙에 위험을 야기한다는 사실을 인정하고서 그 위험을 감쇄하기 위해 추상적 위험범을 제한적으로 해석하거나 그 유용성을 강조하는 길을 택해 왔다. 그러나 이러한 주류에서 벗어나 추상적 위험범은 비례원칙・책임원칙과 상충하지 않으며 따라서 그 사정권을 축소하거나 그 정당성을 예외적으로만 시인할 필요는 없다고 주장하는 학자도 있다. 그 대표적인 예로는 디트리히 크라취(Dietrich Kratzsch)와 우어스 킨트호이저(Urs Kindhäuser)를 들 수 있다. 두 학자는 추상적 위험범의 필요성이나 유용성만 부각하는 피상적인 논거를 넘어서서 형법의 불법론을 근본적으로 성찰함으로써 추상적 위험범의 존재 근거를 확보하려 한다. 이 글에서는 두 학자의 불법론과 그에 기초한 추상적 위험범론을 ― 김영환 교수가 계승하는 전통적인 ‘자유주의적 법치국가’ 사상에 기초하여 ― 분석・평가해 보았다. Abstrakte Gefährdungsdelikte sind heute zum Lieblingskind des Strafgesetzgebers geworden. Zwar lässt sich kaum bestreiten, dass sie eine legitime Ausdrucksweise des Strafrechts sind. Dass sie aber in Konflikt mit dem Schuldprinzip geraten können, kann man auch nicht leugnen. Heftig diskutiert wird daher, ob und inwieweit sie sich legitimieren lassen. Um diese Frage zu beantworten, bestreben sich Kratzsch und Kindhäuser, die herrschende Unrechtslehre umzugestalten und dadurch nach neuen Ansätzen zu suchen, die abstrakte Gefährdungsdelikte rechtfertigen können. Einerseits behauptet Kratzsch, das Strafrecht müsse darauf zielen, Unrecht möglichst effektiv zu bekämpfen und damit Rechtsgüter möglichst lückenlos zu schützen. Dann hält er es für richtig und nötig, abstrakte Gefährdungsdelikte aktiv einzusetzen, um den Zufall zu beherrschen, der die Verwirklichung des optimalen Rechtsgüterschutzes verhindert. Andererseits geht Kindhäuser davon aus, dass Strafrechtnormen nur dann materiell legitimiert werden können, wenn sie als “Selbstzwecknormen” ausgestaltet werden. Anschließend deutet er abstrakte Gefährdungsdelikte als Selbstzwecknormen, die es verbieten, die zur sorgelosen Verfügung über Güter notwendigen Sicherheitsbedingungen zu beeinträchtigen. In diesem Artikel habe ich die neuen Unrechtslehren von Kratzsch und Kindhäuser, die abstrakte Gefährdungsdelikte verteidigen, unter die Lupe genommen und untersucht, ob sie die herrschende Unrechtslehre, die abstrakte Gefährdungsdelikte bezweifelt, ersetzen können und sollen.