태아와 성인의 배양된 섬유아세포의 교원질 합성양상의 비교

나동균,노태석,박병윤,이광훈 大韓成形外科學會 1999 Archives of Plastic Surgery Vol.26 No.3

With the development of antenatal diagnostic tools such as ultrasonography, some congenital anomalies or diseases can be detected in early fetal life. Routine serial antenatal check-ups have made it possible to predict the prognosis of these problems, and a few life-threatening single anatomic malformations have been treated by open fetal surgery. The experience of fetal surgery revealed that the human fetus appears to heal without any scarring. In contrast to adult animals, the response to tissue injury in the fetus is conspiciously devoid of acute inflammation. Indeed, the absence of neutrophils is perhaps the most consistent observation in fetal wounds and seems to be followed by absent or scanty fibroblast infiltration, which results in healing with sparse and well organized collagen deposition. Actually, the amount and quality of the collagen deposition were decided by the fibroblasts which infiltrated the wound. It is well known that fetal wounds have sparse collagen deposition, however, the mechanisms are still unclear. This study was designed to evaluate the role of fibroblast activity in the differences of the scar formation between the fetus and neonate. Fibroblast activity such as the cell growth rate, the amount of collagen synthesis and the synthesized collagen types of fetus(IUP 18-22 weeks) was compared with that of neonate. The amount of collagen synthesis was measured by H-proline uptake and the amount of collagen type Ⅲ was measured by Western blot using antihuman procollagen typeⅢ. The cell growth rate as determined by cell proliferation from the initial cell count of 5x10? to cell confluence was 3.6 x 10 in the fetal fibroblasts compared to 2.5x10? in neonatal fibroblasts. Fetal fibroblast synthesize 16.9 x 10⁴ cpm of collagen and neonatal fibroblasts synthesize 2.7 x 10⁴ cpm of collagen. The synthesized amount of type Ⅲ collagen was 2.1x10⁴ ug/ml, and 1.5x10⁴ ug/ml by fetal and neonatal fibroblasts, respectively. In conclusion, fetal fibroblasts grow faster and synthesize a smaller amount of collagen, but produce more type Ⅲ collagen than neonatal fibroblasts.

Looking Forward to the First Impact Factor of Archives of Plastic Surgery

Roh, Tai Suk Korean Society of Plastic and Reconstructive Surge 2015 Archives of Plastic Surgery Vol.42 No.6

A Scientometric Analysis of 20 Years of Research on Breast Reconstruction Surgery: A Guide to Research Design and Journal Selection

Roh, Tai Suk Korean Society of Plastic and Reconstructive Surge 2013 Archives of Plastic Surgery Vol.40 No.2

Contemporary Breast Reconstruction; Recent Updates and Consensus

Tai Suk Roh 대한외과학회 2019 대한외과학회 학술대회 초록집 Vol.2019 No.10

Raynaud 증후군의 임상 치험례

오석준,은석찬,노태석,범진식 大韓成形外科學會 1999 Archives of Plastic Surgery Vol.26 No.6

Raynaud's phenomenon manifests as triphasic color change episodes of blanching, cyanosis, and reddening of the digits, induced by exposure to low temperature or emotional stress. It is a relatively common disorder, estimated to affect 5-10% of the general population and 20-30% of otherwise healthy women. Most cases of primary Raynaud's phenomenon also called Raynaud's disease, are mild and self-limited. Secondary Raynaud's phenomenon presents as a secondary manifestation of an underlying disease and are complicated by ulcerations and tissue necrosis. From March 1996 to August 1998, we experienced 4 patients with Raynaud's phenomenon. Two patients were diagnosed Raynaud's disease and the other two were secondary. Raynaud's disease responded to drug therapy and sympatetic ganglion block. Secondary Raynaud's syndrome was treated with vein graft and free tissue transfer. During postoperative follow-up of 33-49 months, both severity and symptomatic intervals were improved.

열성경련 플러스에서 SCN1A-exon 9의 단일염기다형성

노석만(Suk-Man Roh) 엄태훈(Tae-Hun Eom) 김진모(Jinmo Kim) 김영훈(Young-Hoon Kim) 정승연(Seung-Yun Chung) 이인구(In-Goo Lee) 황경태(Kyung-Tai Whang) 이권행(Kweon-Haeng Lee) 대한소아신경학회 2004 대한소아신경학회지 Vol.12 No.1

목적 : 열성경련은 6세 이하 소아와 2-5%에서 경험하는 비교적 흔한 질환이다. 열성경련을 경험한 소아의 일부는 나중에 비열성경련성질환과 간질로 발전한다. 열성경련 플러스(generalized epilepsy with febrile seizure plus, GEFS+)는 열성경련과 다양한 정도의 전신발작 등 이질적인 표현형을 가진 중요한 유전학적간질증후군이다. 전압관문나트륨채널 아형(voltage-gated sodium, channel subunit) 유전자인 SCN1A의 돌연변이는 열성경련 플러스(GEFS+)를 보이는 상염색체우성 전신간질과 중증 근간대성 간질을 보이는 영아의 열성경련과 관련이 있는 것으로 알려지고 있다. 저자들은 GEFS+와 열성경련으로 진단받은 환아를 대상으로 SCN1A 유전자의 다형성을 알아보기 위하여 본 연구를 시행하였다. 방법 : 가톨릭대학교 의정부성모병원 및 성모자애병원 소아과에서 GEFS+로 진단받은 환아 22명과 열성경련 환아 62명을 대상으로 하여 SCN1A 유전자의 돌연변이를 분석하였다. SCN1A 유전자 exon 9의 증폭은 primer쌍(Foward GGAGGGTGAGACGCTGACTC, Reverse CACCTGGAGCTCCCCAGCTG)을 가지고 touchdown PCR 방법을 수행하였으며 DHPLC를 이용하여 exon 9의 1212에서 SNP(G/A)을 확인하였다. 이후 DHPLC에 의하여 분석된 각 유형에 대하여 염기서열법을 시행하였다. 결과 : 두 가족을 포함한 대상 총 84명 중 GEFS+ 환아군은 22명, 열성경련 환아군은 62명이었다. 열성경련의 형태는 GEFS+ 환아군에서는 단순열성경련 5명, 복합열성경련 17명, 열성경련 환아군에서는 단순열성 49명, 복합열성경련 13명이었다. 열성경련 환아군에서 간질이나 열성경련의 가족력이 있었던 환아는 43.5%이었다. 연령 분포를 보면 평균연령은 GEFS+ 환아군에서 9.1세였으며 12개월에서 33개월 미만 22.74%, 36개월 이상 7세 미만이 18.2%, 7세 이상이 59.1%이었고, 열성경련 환아군에서 2.4세이었으며 12개월 미만 11.3%, 12개월에서 36개월 미만 46.8%, 36개월 이상 7세 미만이 41.9%이었다. 남녀비는 GEFS+ 환아군에서 1.75:1이며 열성경련 환아군에서 1.82:1이었다. SCN1A exon 9의 돌연변이 검사상 exon 9의 1212의 위치에 SNP(G/A)은 84명 중 11명에서 발견되었고 intron부분에서 SNP(G/A)는 84명 중 52명에서 발견되었다. 동종접합유전자형(G/G)에서 intron A/A는 73명 증 22명에서 intron G/G는 5명에서 발견되었다. 이중 이미 보고된 exon 9의 1212에서 돌연변이(1212 G/A intron G/G)는 84명 중 5명이었다. GEFS+와 열성경련 환아에서 1212 G/G intron A/A 또는 G/G, 1212 G/G intron G/A, 1212 G/A intron G/A, 이미 보고된 1212 G/A의 단일염기다형성 빈도에는 통계학적으로 유의한 차가 없었다. 결론 : 비록 GEFS+환아와 열성경련 환아에서 SCN1A유전자의 exon9 다형성이 현저한 차이가 없는 것으로 나왔지만 임상적 인자를 고려한 광범위한 연구가 필요하다 Purpose : Febrile seizures affect 2-5% of all children younger than 6 years old. A small proportion of children with febrile seizures later develop epilepsy. Muations in the voltage-gated sodium channel subunit gene SCN1A have been associated with febrile seizures(FSs) in autosomal dominant generalized epilepsy with febrile seizures plus (GEFS +) families and severe myoclonic epilepsy of infancy. The present study assessed the role of SCN1A in familial typical FSs. Methods: 22 GEFS+ and 62 FSs were selected throughout a collaborative study of Catholic Child Neurology Research Group. The exon 9 region of SCN1A was screened by DHPLC. DNA fragments showing variant chromatograms were subsequently sequenced. Results: A total 84 individuals(22 GEFS+ and 62 FSs) was screened for mutations. Among 22 GEFS+ and 62 FSs patients, five and forty nine showed simple FSs, and seventeen and thirteen had complex FSs. 0% and 8.3% were younger than 12 months old, 22.7% and 46.8% were between 12 and 35 months old, 18.2% and 41.9% were between 36 and 83 months old, and 59.1% and 0% were older than 84 months old. The ratios of male to female were 1.75: 1 and 1.82: 1. Mutational analysis detected no mutation of SCN1A. Mutational analysis detected eleven silent exonic polymorphisms at G1212A in exon 9 and forty two polymorphisms on intron 9, and 23 intron A/As in 73 homozygote samples. There were no significant differences in allelic frequencies(G/G intron A/A or G/G, G/G intron G/A, G/A intron G/A, reported G/A) of G1212A in SCN1A-exon 9 between the patients with GEFS+ and FSs(31.8% vs. 32.3%, 54.5% vs. 54.8%, 9% vs. 6.5%, 4.5% vs. 6.5%). Conclusion : Although our study demonstrated that SCN1A is not frequently involved in GEFS+ and FSs, further systemic research would be necessary.

Age-dependent immune response in pigs against foot-and-mouth disease virus in vitro

( Jae-hee Roh ),( Ngoc Anh Bui ),( Hu Suk Lee ),( Vuong Nghia Bui ),( Duy Tung Dao ),( Thanh Thi Vu ),( Thuy Thi Hoang ),( Kyoung-min So ),( Seung-won Yi ),( Eunju Kim ),( Tai-young Hur ),( Sang-ik Oh 한국축산학회 2021 한국축산학회지 Vol.63 No.6

Foot-and-mouth disease, one of the most contagious diseases in cloven-hoofed animals, causes significant economic losses. The pathogenesis of foot-and-mouth disease virus (FMDV) infection is known to differ with age of the animals. In this study, we aimed to reveal the difference in immunological response in the initial stage of FMDV infection between piglets and adult pigs. Peripheral blood mononuclear cells (PBMCs) were isolated from 3 piglets (8 weeks old) and 3 pigs (35 weeks old) that were not vaccinated against FMDV. O-type FMDV (2 × 10² median tissue culture infectious dose) was inoculated into porcine PBMCs and the cells were incubated at 37.0℃ under 5% CO₂ for various time periods (0, 1, 3, 6, 12, 24, and 48 h). The total RNA was obtained from the FMDV-inoculated PBMCs after each time point, and the virus titer was investigated in these RNA samples. Furthermore, dynamics of mRNA expression of the six tested cytokines (interferon [IFN]-α, IFN-γ, interleukin [IL]-6, IL-8, IL-10, and tumor necrosis factor [TNF]-α) in FMDV-inoculated porcine PBMCs were evaluated by time-series analysis to determine the differences, if any, based on the age of the pigs. The PBMCs of piglets contained the highest quantity of FMDV mRNA at 6 hours post-inoculation (hpi), and the PBMCs of pigs had the highest quantity of FMDV mRNA at 3 hpi. The mean cycle threshold-value in the PBMCs steadily decreased after the peak time point in the piglets and pigs (6 and 3 hpi, respectively). The dynamics of mRNA expression of all cytokines except TNF-α showed age-dependent differences in FMDV-inoculated PBMCs. The mRNA expression of most cytokines was more pronounced in the piglets than in the pigs, implying that the immune response against FMDV showed an age-dependent difference in pigs. In conclusion, within 48 hpi, the 8-week-old piglets responded more rapidly and were more sensitive to FMDV infection than the 35-week-old pigs, which could be associated with the difference in the pathogenesis of FMDV infection among the pigs. These results provide valuable insights into the mechanisms underlying the age-dependent differences in immune response in pigs against FMDV infection.

Time-Varying Expected Momentum Profits

Dongcheol Kim,Tai-Yong Roh,Suk-Joon Byun,Byoung-Kyu Min 한국재무학회 2012 한국재무학회 학술대회 Vol.2012 No.05

We examine time variations of the expected momentum profits using a two-state Markov switching model with time-varying transition probabilities to evaluate the empirical relevance of recent rational theories of the momentum profits. We find that in the expansion state the expected returns of winner stocks are more affected by aggregate economic conditions than those of loser stocks, while in the recession state the expected returns of loser stocks are more affected than those of winner stocks. Consequently, the expected momentum profits display strong procyclical variations. We argue that the observed momentum profits are realizations of such expected returns and can be interpreted as the procyclicality premium. We also find the economic significance of out-of-sample predictability of the momentum profits particularly for loser stocks and during the recession states.

공동주택 현장에서 피뢰시스템 적용 실태 및 자연적구성부재의 활용 방안 연구

노준석(Jun-Suk Roh),주태경(Tai-kyung Joo),김경원(Kyung-Won KIM),황병인(Byung-In Whang) 한국조명·전기설비학회 2019 한국조명·전기설비학회 학술대회논문집 Vol.2019 No.11

Immediate Partial Breast Reconstruction with Endoscopic Latissimus Dorsi Muscle Flap Harvest

Yang, Chae Eun,Roh, Tai Suk,Yun, In Sik,Kim, Young Seok,Lew, Dae Hyun Korean Society of Plastic and Reconstructive Surge 2014 Archives of Plastic Surgery Vol.41 No.5

Background Currently, breast conservation therapy is commonly performed for the treatment of early breast cancer. Depending on the volume excised, patients may require volume replacement, even in cases of partial mastectomy. The use of the latissimus dorsi muscle is the standard method, but this procedure leaves an unfavorable scar on the donor site. We used an endoscope for latissimus dorsi harvesting to minimize the incision, thus reducing postoperative scars. Methods Ten patients who underwent partial mastectomy and immediate partial breast reconstruction with endoscopic latissimus dorsi muscle flap harvest were reviewed retrospectively. The total operation time, hospital stay, and complications were reviewed. Postoperative scarring, overall shape of the reconstructed breast, and donor site deformity were assessed using a 10-point scale. Results In the mean follow-up of 11 weeks, no tumor recurrence was reported. The mean operation time was 294.5 (${\pm}38.2$) minutes. The postoperative hospital stay was 11.4 days. Donor site seroma was reported in four cases and managed by office aspiration and compressive dressing. Postoperative scarring, donor site deformity, and the overall shape of the neobreast were acceptable, scoring above 7. Conclusions Replacement of 20% to 40% of breast volume in the upper and the lower outer quadrants with a latissimus dorsi muscle flap by using endoscopic harvesting is a good alternative reconstruction technique after partial mastectomy. Short incision benefits from a very acceptable postoperative scar, less pain, and early upper extremity movement.