http://chineseinput.net/에서 pinyin(병음)방식으로 중국어를 변환할 수 있습니다.
변환된 중국어를 복사하여 사용하시면 됩니다.
Neuropeptide Y Promotes the Treatment of Adipose Stem Cells on Type 2 Diabetic Wounds
Lu Tinghuan,Cong Lu,Jiang Tong,Dong Xiao,Song Lili 한국조직공학과 재생의학회 2023 조직공학과 재생의학 Vol.20 No.5
BACKGROUND: Type 2 diabetes (T2D) is a common metabolic disorder. Due to insufficient insulin secretion or insulin resistance, increased blood glucose often leads to impaired wound healing in T2D patients. Our previous research showed that adipose-derived stem cells (ASCs) from normal mice and T2D mice improved the cutaneous wound healing of diabetic mice. We also found that the expression of neuropeptide Y (NPY) in T2D ASCs was significantly decreased. METHODS: In order to explore the effects of NPY on ASCs and diabetic wound healing, we investigated the effects of NPY on ASCs proliferation and growth factors expression and secretion, the effects of NPY on skin fibroblasts, and the effects of NPY combined with ASCs on T2D wound healing. RESULTS: The results showed that a certain concentration of NPY could promote the proliferation and the growth factors expression and secretion of ASCs, and promote the proliferation and migration of fibroblasts. At the same time, NPY and ASCs have a synergistic effect, which can promote wound healing and decrease inflammation in T2D wounds. NPY may regulate ASCs through the ERK pathway. These results are conducive to promoting ASCs and NPY in the treatment of diabetic wounds. CONCLUSIONS: NPY can promote the effect of ASCs in the treatment of diabetic wounds.
Lili Zhou,Hua Jiang,Juan Du,Lu Li,Rong Li,Jing Lu,Weijun Fu,Jian Hou 생화학분자생물학회 2018 Experimental and molecular medicine Vol.50 No.-
USP15 has been shown to stabilize transcription factors, to be amplified in many cancers and to mediate cancer cell survival. However, the underlying mechanism by which USP15 regulates multiple myeloma (MM) cell proliferation and apoptosis has not been established. Here, our results showed that USP15 mRNA expression was upregulated in MM patients. USP15 silencing induced MM cell proliferation inhibition, apoptosis, and the expression of nuclear and cytoplasmic NF-κBp65, while USP15 overexpression exhibited an inverse effect. Moreover, in vivo experiments indicated that USP15 silencing inhibited MM tumor growth and NF-κBp65 expression. PDTC treatment significantly inhibited USP15 overexpression-induced cell proliferation, apoptosis inhibition, and NF-κBp65 expression. USP15 overexpression promoted NF-κBp65 expression through inhibition of its ubiquitination, whereas NF-κBp65 promoted USP15 expression as a positive regulator. Taken together, the USP15-NF-κBp65 loop is involved in MM tumorigenesis and may be a potential therapeutic target for MM.
Lili Yang,Zhenxiang Xu,Hongqi Li,Cuiying Wang,Yunqin Wang,Congcong Lu 한국섬유공학회 2021 Fibers and polymers Vol.22 No.4
A new dye intermediate and novel reactive dyes containing both azo and benzsulfonamide auxochromic groupswere synthesized. Their structures were characterized by 1H-NMR, 13C-NMR, MS, IR, and UV-Vis spectral analysis. Thesynthesized dyes were applied to dyeing of cotton fabrics and their dyeing parameters were assessed. The new dyes exhibitedimproved substantivity and fixation property on cotton fabrics compared with the dye C.I. Reactive Black 5 (RB5). Themaximum exhaustion and total fixation values of the reactive dyes appeared when 2 % owf of the dye concentration wasused. The wash fastness and rub fastness of the new dyes reached up to 4 grade and 4-5 grade, respectively. In addition, theyshowed excellent fastness to light. These new dyes seem to be promising candidates for application to dyeing of cotton fibers.
The Effects of Multi-minerals on Susceptibility to Lead Toxicity in Rats
Lu, Jing,Zhang, Jun,Zhang, Lili,Cui, Tao,Xie, Guangyun,He, Xiwen The Korean Society of Toxicology Korea Environment 2001 Toxicological Research Vol.17 No.-
Female Wistar rats were randomly divided into 5 groups: Control, received distilled water; Low lead, received 0.5 g/ιlead (as acetate) in drinking water; High lead, received 2.0 g/ιlead; Low lead + Minerals, received 0.5 g/ιlead in drinking water and received minerals (Ca$^{2+}$, 25 mg/kg/day; Fe$^{3+}$, 0.47 mg/ kg/day; Zn$^{2+}$, 0.33 mg/kg/day; Se, 0.83 $\mu\textrm{g}$/kg/day) by gavage; High lead + Minerals, received 2.0 g/ιlead and received the same minerals. Animals exposure to lead was from 10 days before mating till postnatal day 21; and the minerals was administered from the first day of pregnancy and during lactation. No statistical difference was found either in body weights or in blood lead levels between the pups received minerals and those only exposed to lead at the same dose. The developmental and behavioral teratological effects of lead on pups, such as time-lag of eye opening, pinna detachment, fur developing, incisor eruption, ear unfolding, and surface righting were observed in this study; and the minerals decreased the toxicity of lead either in low or in high lead exposure pups. The numbers of step-down were significantly increased in lead exposed animals, and the effect of intervention by the minerals was appeared only in the pups exposed to low lead. The ChAT activity and levels of glutamate and aspartate in hippocampus decreased in treated animals compared to control animals, no effect of intervention by the minerals was found. The results of this study indicate that the applied multi-minerals can alter the outcome of develop-mental lead poisoning in rats.s.s.s.
Two Types of Immunoassay Based on Nile Blue Labeling Polydopamine Nanospheres
Lili Liu,Wenbo Lu,Chang Liu,Ying Wang,Jian Dong,Weiping Qian 성균관대학교(자연과학캠퍼스) 성균나노과학기술원 2017 NANO Vol.12 No.8
The sandwich-type immunoassays have been developed by using electrochemical and surface-enhanced Raman scattering (SERS) techniques for the detection of carcinoembryonic antigen (CEA). Nile blue as a kind of Raman dye has been decorated on nanospheres with polydopamine resin (PDR) via π-stacking interaction. The Nile blue displays the strong SERS signals as well as a characteristic electrochemical reduction peak at -0.33V (versus Ag/AgCl). The implementation of the PDR nanospheres mixing with Au nanoparticles (AuNPs/PDR) exhibits a better electrical conductivity and large SERS enhancement. The immunoassays based on Nile blue-labeled AuNPs/PDR nanospheres have been fabricated by using electrochemical and SERS techniques for the detection of CEA. The proposed immunoassay shows higher sensitivity, high selectivity, lower detection limit and long-term stability. The performances of the electrochemical immunoassay are better than that of SERS immunoassay. For the electrochemical immunoassay, the linear range occurs from 1 pg/mL to 100 ng/mL (R = 0.995) with a detection limit of 0.68 pg/mL and signal-to-noise ratio of 3 in the detection of CEA. The data for the analysis of human serum samples by using the electrochemical method are acceptably consistent with those obtained from the enzyme-linked immunosorbent assay (ELISA). The proposed immunoassay exhibits a promising potential for application in clinical diagnosis.
( Jia Lu ),( Lili Shi ),( Dan Huang ),( Wenjuan Fan ),( Xiaoqing Li ),( Liming Zhu ),( Jing Wei ),( Xiucai Fang ) 대한소화기기능성질환·운동학회(구 대한소화관운동학회) 2020 Journal of Neurogastroenterology and Motility (JNM Vol.26 No.4
Background/Aims A strong correlation between depression and irritable bowel syndrome with diarrhea (IBS-D) has been identified. The aim of this study is to identify the correlations among depression, structural factors, gastrointestinal (GI) and extra-GI symptoms, and efficacy of neuromodulators in patients with IBS-D. Methods Patients meeting the Rome III Diagnostic Criteria for IBS-D were enrolled. The intestinal symptoms and psychological states were evaluated using IBS-specific symptom questionnaires and Hamilton Depression Rating Scale. Results In total, 410 patients with IBS-D were enrolled, 28.8% (118/410) had comorbid depression. Patients with depression did not readily experience improvement in abdominal pain/discomfort after defecation, and had a higher prevalence of passing mucus, overlapping functional dyspepsia, and extra-GI symptoms. The structural factor “mental disorders” significantly correlated with main bowel symptom score and degree of pre-defecation abdominal pain/discomfort. No structural factor significantly correlated with bowel movements or stool form. Patients who had passing mucus, overlapping functional dyspepsia and extra-GI painful symptoms have higher score of “anxiety/somatization.” Patients with sexual dysfunction have higher score of “retardation symptoms.” In total, 28.3% of patients with IBS-D were prescribed neuromodulators. Baseline scores of “anxiety/somatization” and “retardation symptoms” positively correlated with improvement of diarrhea after paroxetine, and “sleep disturbances” positively correlated with improvement of abdominal pain/discomfort and diarrhea after mirtazapine. Conclusions Comorbid depression and higher scores of structural factors might aggravate GI and extra-GI symptoms other than bowel movements and stool form. Structural factors of Hamilton Depression Rating Scale correlated with efficacy of paroxetine and mirtazapine in patients with IBS-D. (J Neurogastroenterol Motil 2020;26:505-513)
SURF4 maintains stem-like properties via BIRC3 in ovarian cancer cells
Yongfang Yue,Lili Xia,Shanshan Xu,Conghui Wang,Xinyu Wang,Weiguo Lu,Xing Xie 대한부인종양학회 2020 Journal of Gynecologic Oncology Vol.31 No.4
Objective: As cancer stem cells (CSCs) are considered as the origin of tumor development,recurrence, and drug resistance, we aimed to explore the mechanism related to modulatingstemness in CSCs, thus facilitating to search for new therapeutic strategy for ovarian cancer. Methods: In this study, ovarian cancer stem cells (OCSCs) induced from cell line 3AOand A2780 were enriched in serum-free medium (SFM). The effect of SURF4 on CSC-likeproperties was evaluated by sphere-forming assays, re-differentiation assays, quantitativereal-time polymerase chain reaction, flow cytometry, Western blotting, cell viability assaysand in vivo xenograft experiments. The downstream molecule participating in SURF4maintaining stemness was screened by RNA-sequencing and identified by the experiments ofgene function. Results: SURF4 was upregulated expressed in OCSCs. Knockdown of SURF4 reduced theexpression of the related stem markers (SOX2 and c-MYC), inhibited self-renewal ability,and improved the sensitivity to chemotherapeutic drugs (paclitaxel and cisplatin) in OCSCs. SURF4 knockdown also inhibited tumorigenesis in nonobese diabetic/severe combinedimmunodeficiency mice. BIRC3 expression was controlled by SURF4, and BIRC3 showedthe similar effect as SURF4 did, and BIRC3 overexpression partially recovered stem-likeproperties abolished by SURF4 knockdown. Conclusion: Our findings suggest that SURF4 possesses the ability to maintain stemness ofOCSCs via BIRC3, and may serve as a potential target in stem cell-targeted therapy forovarian cancer.
Prevalence of Seasonal Influenza Viruses and Pandemic H1N1 Virus in Beijing from 2008 to 2012
Shujuan Cui,Lili Tian,Xiaomin Peng,Guilan Lu,Weixian Shi,Dongmei Meng,Quanyi Wang 대한진단검사의학회 2012 Annals of Laboratory Medicine Vol.32 No.6
In northern China, influenza circulates on a seasonal and regular basis during the winter-spring season [1]. Our study was conducted in Beijing between November 2008 and March 2012, specifically from November 2008 to March 2009 (period 1), from November 2009 to March 2010 (period 2), from November 2010 to March 2011 (period 3), and from November 2011 to March 2012 (period 4), in order to evaluate the annual incidence rates of influenza and to identify the circulating viral types and subtypes for facilitating the local vaccination programs and regional influenza control. Virological prevalence, the subject of the surveillance, was defined based on the influenza-like illnesses (ILIs) as follows: a temperature of ≥38˚C, either cough or sore throat, and no laboratory- confirmed evidence of another disease in patients who presented at the Fever Outpatient Clinic Department of the sentinel hospitals. Over the 4 yr, 6,397 throat swab samples from outpatients with ILIs were collected and tested. The ages of outpatients ranged between 6 months and 91 yr (median, 32 yr; mean, 37.1 yr). Specimens were collected from both female (n=3,338; 52.18%) and male (n=3,059; 47.82%) patients. Total RNA was extracted from 100 μL of each sample using QIAmp Viral RNA Mini kit (QIAGEN, Valencia, CA, USA); subsequently, they were analyzed by real-time (RT) PCR methods for influenza viruses, as recommended by the Chinese National Influenza Center, including seasonal influenza viruses such as FluA(H1N1), FluA(H3N2), FluB, and pdmH1N1 under the same testing conditions and procedures with the exception of the respective primers and probe, i.e., FluA(H1N1)-F, AACATGTTACCCAGGGCATTTCGC; FluA(H1N1)-R, GTGGTTGGGCCATGAGCTTTCTTT; FluA(H1N1)-P, GAGGAACTGAGGGAGCAATTGAGTTCAG; FluA (H3N2)-F, ACCCTCAGTGTGATGGCTTCCAAA; FluA(H3N2)-R, TAAGGGAGGCATAATCCGGCACAT; FluA(H3N2)-P, ACGCAGCAAAGCCTACAGCAACTGT; FluB-F, TCCTCAACTCACTCTTCGAGCG; FluB-R, CGGTGCTCTTGACCAAATTGG; FluB-P, CCAATTCGAGCAGCTGAAACTGCGGTG; pdmH1N1-F, GGGTAGCCCCATTGCAT; pdmH1N1-R, AGAGTGATTCACACTCTGGATTTC;and pdmH1N1-P, TGGGTAAATGTAACATTGCTGGCTGG. Real-time (RT) PCR was performed using AgPath-IDTM One-Step RT-PCR Kit (Applied Biosystems International, Foster City, CA, USA) with an ABI Prism 7500 Taqman machine (Applied Biosystems International). The reaction was conducted at a total volume of 25 μL containing 12.5 μL of 2×RT-PCR buffer, 1 μL of 2×RT-PCR enzyme, 1.67 μL of detection enhancer, 400 nM of each primer, 200 nM of probe, 3.33 μL of double distilled water (ddH2O), and 5 μL of template. Optimized amplification conditions were as follows: 1 cycle of 50˚C for 30 min, followed by 10 min at 95˚C, and 45 cycles of 15 sec at 95˚C and 45 sec at 55˚C. Influenza viruses were detected in 6,397 clinical samples of outpatients with ILIs at peak times, with varying compositions of influenza numbers. Fluctuating trends were observed in Beijing, China, over the 4 continuous periods. The results of prevalence of common seasonal influenza are summarized in Fig. 1. From period 1 to period 4, the positive prevalence rate of FluA(H1N1) decreased sharply year by year (period 1, 8.12%; period 2, 2.9%; period 3, 0.32%; and period 4, 0%), especially for period 4, where no positive case of FluA(H1N1) was recorded. Conversely, pdmH1N1 gradually replaced FluA(H1N1) from the start of the 2009 epidemics (period 1, 0%; period 2, 25.64%; period 3, 10.71%; and period 4, 4.65%). FluA(H3N2) and FluB also present fluctuating changes in the positive detection rate of the surveillance;they are the predominant viral members of seasonal influenza due to the principle of dominance by competitive circulation, whereby 1 type or subtype of seasonal influenza virus becomes the predominant form while the other types and subtypes of seasonal influenza virus play a secondary role. The predominant positive detection rates over the 4 periods were: FluA(H3N2), 10.88%; pdmH1N1, 25.64%; FluA(H3N2), 12.39%; and FluB, 15.37%. Especially in...
Pan Yibin,Yan Lili,Chen Qiaoqiao,Wei Cheng,Dai Yongdong,Tong Xiaomei,Zhu Haiyan,Lu Meifei,Zhang Yanling,Jin Xiaoying,Zhang Tai,Lin Xiaona,Zhou Feng,Zhang Songying 생화학분자생물학회 2021 Experimental and molecular medicine Vol.53 No.-
In early pregnancy, the placenta anchors the conceptus and supports embryonic development and survival. This study aimed to investigate the underlying functions of Shh signaling in recurrent miscarriage (RM), a serious disorder of pregnancy. In the present study, Shh and Gli2 were mainly observed in cytotrophoblasts (CTBs), Ptch was mainly observed in syncytiotrophoblasts (STBs), and Smo and Gli3 were expressed in both CTBs and STBs. Shh signaling was significantly impaired in human placenta tissue from recurrent miscarriage patients compared to that of gestational age-matched normal controls. VEGF-A and CD31 protein levels were also significantly decreased in recurrent miscarriage patients. Furthermore, inhibition of Shh signaling impaired the motility of JAR cells by regulating the expression of Gli2 and Gli3. Intriguingly, inhibition of Shh signaling also triggered autophagy and autolysosome accumulation. Additionally, knockdown of BECN1 reversed Gant61-induced motility inhibition. In conclusion, our results showed that dysfunction of Shh signaling activated autophagy to inhibit trophoblast motility, which suggests the Shh pathway and autophagy as potential targets for RM therapy.
Jing Guo,Jin Lu,Xianghui Wang,Lili Zhou 한국전자통신연구원 2023 ETRI Journal Vol.45 No.2
This paper investigates the effect of hardware impairments (HIs) and imperfect channel state information (ICSI) on a SWIPT-assisted adaptive nonorthogonal multiple access (NOMA)/orthogonal multiple access (OMA) system over independent and nonidentical Rayleigh fading channels. In the NOMA mode, the energy-constrained near users act as a relay to improve the performance for the far users. The OMA transmission mode is adopted to avoid a complete outage when NOMA is infeasible. The best user selection scheme is considered to maximize the energy harvested and avoid error propagation. To characterize the performance of the proposed systems, closed-form and asymptotic expressions of the outage probability for both near and far users are studied. Moreover, exact and approximate expressions of the ergodic rate for near and far users are investigated. Simulation results are provided to verify our theoretical analysis and confirm the superiority of the proposed NOMA/OMA scheme in comparison with the conventional NOMA and OMA protocol with/without HIs and ICSI.