http://chineseinput.net/에서 pinyin(병음)방식으로 중국어를 변환할 수 있습니다.
변환된 중국어를 복사하여 사용하시면 됩니다.
Je‑Oh Lim,Je‑Won Ko,Tae‑Yang Jung,Woong‑Il Kim,So‑Won Pak,In‑Sik Shin,Won‑Kee Yun,Hyoung‑Chin Kim,Jeong‑Doo Heo,Jong‑Choon Kim 대한독성 유전단백체 학회 2020 Molecular & cellular toxicology Vol.16 No.3
Background Silica dioxide nanoparticles (SiONPs) have been used for various medical applications, including therapeutics and imaging, and the use of SiONPs has increased gradually over the years. However, despite an increase in the use of SiONPs, not much is known about mechanism of action of SiONPs and their pulmonary toxicity. Objective The present study investigated the pulmonary toxicity of SiONPs and explored the underlying mechanism of action, primarily focusing on thioredoxin-interacting protein (TXNIP)/NOD-like receptor pyrin domain-containing 3 (NLRP3) in SiONPs-treated mice. We investigated the toxic effects of SiONPs in the lung of BALB/c mice administered 5, 10, and 20 mg/kg SiONPs for 3 days. Results Exposure to SiONPs markedly increased inflammatory cell counts, including those of neutrophils and macrophages, and levels of inflammatory mediators, such as interleukin (IL)-1β, IL-6, and tumor necrosis factor-α in a dose-dependent manner in the bronchoalveolar lavage fluid. Moreover, the inflammation was verified upon histopathological analysis. In addition, exposure to SiONPs increased the expression of TXNIP in a dose-dependent manner and, in turn, upregulated NLRP3 inflammasome proteins, which subsequently induced IL-1β production. Conclusion Collectively, exposure to SiONPs induced inflammation in the lungs of mice, which resulted in the activation of IL-1β production via the TXNIP-NLRP3 axis. Our results provide useful information on the pulmonary toxicity induced by SiONPs and provide insights into the underlying mechanism of action.
Je-Oh Lim,Se-Jin Lee,Woong_Il Kim,So-Won Pak,In-Sik Shin,Jong-Choon Kim 한국실험동물학회 2021 한국실험동물학회 학술발표대회 논문집 Vol.2021 No.7
Yijin-tang is an oriental traditional herbal prescription used to treat inflammatory diseases. In present study, we investigated the protective effect of Yijin-tang water extract (YTE) in an ovalbumin (OVA)-induced asthma model focusing on its antioxidatant and anti-inflammatory properties. BALB/c mice were intraperitoneally injected with OVA on days 0 and 14; then, they were challenged with OVA on days 21, 22, and 23. YTE (200 and 400 mg/kg) was orally administered from day 18 to 23. Subsequently, YTE significantly decreased the elevation of airway hyperresponsiveness and, recruitment of inflammatory cells, cytokines, and OVA-specific immuno-globulin E in asthmatic mice. Additionally, YTE was associated with a marked reduction in airway inflammation and mucus production in the lung tissue of asthmatic mice. Further, YTE suppressed matrix metalloproteinase-9 expression and ERK phosphorylation in the lung, which was accompanied by a reduction in inducible nitric oxide synthases and an elevation in reduced glutathione and heme oxygenase-1. In conclusion, YTE effectively suppressed allergic responses in the asthmatic mice and the effect was closely related to its antioxidant and anti-inflammatory properties. Our results indicate that YTE may be a potential material in the treatment of allergic asthma.
Brief introduction of Butterfly(Lepidoptera) from Myanmar
Ja Lang LIM,Jinyoung PARK,Ik Je CHOI,Yong Kyun OH,Eui Seok JEONG,Dong Pyeo LYU,U Pho Cho,Khin Mar Myint,Khin Mar Yi,Jong Kyun PARK 한국응용곤충학회 2013 한국응용곤충학회 학술대회논문집 Vol.2013 No.04
Myanmar is located in the south-east Asia peninsular and it is flanked by five neighboring states: Bangladesh, India, China, Laos and Thailand. It is located 10~22 degree north latitude, to 92~101 degrees east longitude. Myanmar has a tropical climate with three seasons in Myanmar. Hot season (March through April), rainy season (May through October) and the cool season (November through February). The coastal regions can get very hot and humid, especially before the rainy season. Myanmar has a monsoon season from May to October when there are heavy rains and often flooding. The investigation was carried out during the dry season(2013) in Nat Ma Taung National Park and Popa Mountain Park. Popa Mountain Park is located in Kyawpadaung Township, Myinchan district, Mandaly Division. The area is 49.63 square miles. Its coordinates are 29°31'60" N and 27°43'60" E. Nat Ma Taung National Park, Myanmar treasure is in Mindut District of Chin State and its area of 279 square miles. It is the third highest mountain in Myanmar with the height of 10,500 feet. Its coordinates are 21°14'00" N and 93°54'00" E. As the result, butterflies(Lepidoptera) collected in the two regions were about 60 species of 7 familys. Collecting dates, expedition activities, photo of main specimen and information of Myanmar were provided.
Je Hyun Yoo,Ki Deok Park,Oh Kyung Lim,Ju Kang Lee 대한임상신경생리학회 2022 Annals of Clinical Neurophysiology Vol.24 No.1
In cases of hyponatremia induced by brain damage, it is important to distinguish between the syndrome of inappropriate anti-diuretic hormone secretion (SIADH) and cerebral salt wasting syndrome. A ventriculoperitoneal (VP) shunt is the standard treatment for hydrocephalus, and external lumbar drainage (ELD) is an option to evaluate the effect of a VP shunt. However, ELD has potential complications, such as subarachnoid hemorrhage, meningitis, and rarely hyponatremia. Therefore, we report a case of a patient with cerebral salt-wasting syndrome resulting from ELD to treat normal-pressure hydrocephalus during the rehabilitation of acute ischemic stroke.
소아 위생검 조직절편을 이용한 H . pylori 감염 진단에 있어서 PCR 적용의 한계
임재영,고경혁,조명제,김윤옥,오영균,박철근,백승철,이우곤,이광호,우향옥,최명범,조윤경,정양숙,박찬후,윤희상,맹국영 대한소화기학회 1998 대한소화기학회지 Vol.31 No.1
Background/Aims: We tried to evaluate the clinical usefulness of the PCR for the diagnosis of H. pylori infection in children and to identify the possible false positive results by the PCR due to remaining H. pylori in the working channel of an endoscope or in the biopsy forceps. Methods: Forty seven urease test samples with three gastric biopsy specimens, 6 collections of 15 ml flushing distilled water after the end of working channel disinfection, 11 15 ml-distilled-water batches as the negative controls, and one H. pylori positive paraffin block as the positive control were collected at the Gyeongsang National University Hospital. The Hel-2 primer set (GTGTGCGGGCTTACAAGGAT, CGTTAGCGTTCATCACACTC) and a 34 cycle amplification were used Results: All of the seventeen specimens of urease tested positive within 6 hours and the ten specimens of urease also tested positive within 48 hours were PCR positive. Eighteen of the 20 specimens of urease tested negative and were also PCR positive. Three of the 6 specimens of 15 ml flushing distilled water were found to be PCR positive. All the negative controls were PCR negative and the one positive control was PCR positive. Conclusions: The clinical usefulness of PCR using gastric biopsy specimens in children was limited due to the possible dead or live H. pylori remaining in the biopsy channel.