http://chineseinput.net/에서 pinyin(병음)방식으로 중국어를 변환할 수 있습니다.
변환된 중국어를 복사하여 사용하시면 됩니다.
단일 제대 동맥을 가진 건강한 신생아에서 신장 초음파 검사의 유용성
강주미,송은송,국진화,이형신,김소영,최영륜,Kang, Ju-Mi,Song, Eun-Song,Kuk, Jin-Hwa,Lee, Hyung-Sin,Kim, So-Young,Choi, Young-Youn 대한소아청소년과학회 2003 Clinical and Experimental Pediatrics (CEP) Vol.46 No.9
목 적 : 단일 제대 동맥을 가진 건강한 신생아의 약 1/3에서 위장관 폐색 및 요로 기형을 동반할 수 있으므로 요로 기형을 발견하기 위해 초음파 검사를 관습적으로 시행하고 있지만 실제초음파 검사상 이상이 발견되는 경우는 드물다. 이에 저자는 단일 제대 동맥을 가진 건강한 신생아에서 신장 초음파 검사의 유용성을 알아보고자 본 연구를 실시하였다. 방 법 : 1995년 1월부터 2002년 7월까지 출생 후 이학적 검사상 단일 제대 동맥이 있는 신생아에서 단일 제대 동맥이면서 증후군의 일부이거나 수술적 치료가 필요한 심각한 질환이 동반된 경우는 제외하고 건강한 신생아 총 30명을 대상으로 하였다. 임상적 배경과 출생 72시간 이후 신장 초음파를 실시하였고, 신장초음파상 이상이 있는 경우 지속적 추적관찰과 더불어 배뇨성 방광요도 조영술 및 technetium-99m-mercaptoacetyl-triglycerine(MAG3) 신스캔 검사를 실시하여 수신증의 크기, 폐쇄의 정도 및 신기능 변화를 분석하였다. 결 과 : 총 30명의 남녀비는 1 : 1이었으며 평균 재태 연령은 $38.0{\pm}2.56$주, 평균 출생 체중은 $2,780{\pm}690g$이었다. 단일 제대동맥을 가진 건강한 신생아 30명 중 신장 초음파상 이상이 발견 된 례는 5명으로 16.7%이었고, 의미 있는 요로 기형은 1명으로 3.3%이었다. 이상이 발견된 5명 중 4명은 경도의 수신증으로 추적 검사상 자연 소실되었고, 1명은 심한 수신증으로 배뇨성 방광 요도 조영술상 역류는 없었고 MAG3 검사상 좌측 신장 기능 저하가 보여 외래 추적 관찰 중이다. 결 론 : 단일 제대 동맥을 가진 건강한 신생아에서 신장 초음파 검사상 발견된 신장 이상은 16.7%로 일반인에서 보이는 신장 이상의 빈도와 큰 차이는 없었고 1명을 제외한 4명(80.0%)에서 자연 소실되었으므로, 비용-이익 면에서 볼 때 단일 제대 동맥을 가진 건강한 신생아에서 관습적으로 신장 초음파 검사를 실시하는 것에 대해 고려해 볼 필요가 있다고 사료된다. Purpose : It is known that single umbilical artery is frequently associated with gastrointestinal or urogenital anomaly, however, routine renal sonography has been debated in healthy neonate with isolated single umbilical artery. This study is designed to determine the usefulness of routine renal sonography in apparently healthy infants with an isolated single umbilical artery. Methods : Thirty healthy neonates with a single umbilical artery without a major anomaly from January 1995 to July 2002 were enrolled. The authors investigated the clinical background of babies and their mothers after renal sonography after 72 hours of age. When the abnormalities were found at the first renal sonography, the severity of hydronephrosis and degree of obstruction and renal function were analyzed by follow up renal sonography, voiding cystourethrography(VCUG) and technetium-99m-dimercaptosuccinic acid(DMSA) scan or technetium-99m-mercaptoacetyl-triglycerine (MAG3) scan. Results : Among the 30 healthy patients with isolated single umbilical artery, five patients(16.7%) showed abnormalities on first renal sonography with one major(3.3%) and four(13.4%) minor renal anomaly(minimal or mild hydroneohrosis). One major renal anomaly(severe hydronephrosis) showed severe decreased renal function on MAG3 scan without reflux, and the other four minor regressed spontaneously on follow up study. Conclusion : The value of routine early renal sonograpy for detecting renal anomaly in healthy infants with an isolated single umbilical artery remained unclear because most of the anomalies would regress spontaneously in the follow up study.
춤꾼의 마지막 의무를 마친 기록 : 최은희, 『최은희, 한국춤의 긴 여정』(산지니, 2023)
강주미 ( Kang Ju-mi ) 무용역사기록학회 2023 무용역사기록학 Vol.69 No.-
Choi Eun-hee [Choe Eunhui], a choreographer and educator of the Busan area, has compiled records of her dance life and published them as a book titled 『Choi Eun-hee, a Long Journey of Korean Dance』. This book covers the life of the dancer delivered through personal and historical photos. The book encompasses an introduction, performance pictures, the history of Choi Eun-hee's dance and art world, the author's writings, critiques of her performances, conversations, seminars, interviews, newspaper articles, and performance yearbooks. The writings and yearbooks provide information about the past 40 years of dance history in Busan. It is a work that leaves a great contribution to the study of regional dance history. Principally, as the author intended, “this book is meant to be a record, so it is not a popular book. Rather, I hope that it will be stored in an archive or library.”
Free Energy Principle 기반의 Just Noticeable Difference 모델을 활용한 프레임율 향상 기법
강주미(Kang, Ju-Mi),박대준(Park, Dae-Jun),정제창(Jeong, Je-Chang) 한국방송·미디어공학회 2016 한국방송공학회 학술발표대회 논문집 Vol.2016 No.6
본 논문에서는 인간의 시각적 특성을 반영한 Just Noticeable Difference (JND) 모델을 사용한 움직임 예측을 통한 프레임율 향상 기법을 제안한다. 기존의 다중 프레임 기반 움직임 예측을 통한 프레임율 향상 기법은 움직임 벡터의 정확성을 높이기 위해 다중 프레임을 사용하며, 전체 영역에 대해 같은 블록 크기와 탐색 영역으로 움직임 예측을 수행함으로써 불필요한 계산량이 많아지고 움직임 벡터의 부정확한 예측이 수행된다는 단점이 있다. 제안하는 알고리듬은 인간의 시각적 특성을 고려한 Free Energy-based Just Noticeable Difference (FEJND) 모델을 사용하여 이전 프레임과 현재 프레임만을 사용하여 영역 특성에 따른 적응적 움직임 예측을 수행하여 정확성을 높인다. 실험 결과에 따라 제안하는 알고리듬의 성능이 향상되었음을 알 수 있다.
변형된 RBAC 정책에 기반한 효율적인 데이터베이스 보안 관리 시스템
강주미(Jumi Kang),정인아(Mina Jeong),김정자(Jungia Kim),원용관(Yonggwan Won) 한국정보과학회 2003 한국정보과학회 학술발표논문집 Vol.30 No.2Ⅱ
병원, 은행과 같이 중요한 정보를 다루는 조직체들은 그들 데이터를 보호하기 위해 기업 환경과 어플리케이션 특성에 맞는 특별한 데이터베이스 보안 정책을 사용하고 있다. 이러한 대규모의 조직체에서는 업무가 다양하고 복잡하므로 보안정책에 대한 변경이 빈번하게 발생한다. 따라서 보안정책의 무결성을 보존하면서 수시로 변경되는 보안 요구사항을 반영하고 효율적으로 보안관리를 할 수 있는 보안 시스템이 요구된다. 본 연구에서는 조혈계 질환 시료정보관리시스템을 대상으로 IRH(Improved Role Hierarchy)를 이용한 유연성 있는 데이터베이스 보안 시스템을 구현하였다. 데이터 접근은 MAC 방식으로 통제하며, RBAC의 역할계층(Role Hierarchy)을 개선한 IRH를 사용하여 유연성 있는 접근제어를 제공하고 효과적인 보안관리를 할 수 있다. 본 시스템은 보안정책이 바뀔 경우 분산된 보안관리 방식으로 IRH를 수정함으로써 정책 변경이 용이하고 주체의 보안등급이 고정되지 않은 상태에서 IRH을 통해 사용자와 세션이 맺어질 때 결정되므로 정책이 바뀐 후에도 변경된 보안정책이 유연하게 적용된다.
모체의 전자간증이 35주미만 미숙아의 예후에 미치는 영향
강주미 ( Ju Mi Kang ),김소영 ( So Young Kim ),김현희 ( Hyun Hee Kim ),이귀세라 ( Gui Se Ra Lee ),김유정 ( You Jeong Kim ),최성동 ( Sung Doug Choi ),성인경 ( In Kyung Sung ),이원배 ( Won Bae Lee ),전정식 ( Chung Sik Chun ) 대한주산의학회 2003 Perinatology Vol.14 No.1
연구목적:모체의 전자간증이 태아에 스트레스를 가하여 태아의 성숙을 촉진시키므로 미숙아의 유병률을 감소시킨다는 종전의 주장에 대하여 근래에는 상반된 결과와 자료들이 예시되고 있다. 특히 전자간증 산모의 태아에서 폐 성숙과 신경학적 발달, 혈액학적 변화 등에 대하여는 많은 논란이 있다. 본 연구는 35주미만의 미숙아들을 대상으로 산모의 전자간증이 출생 후 신생아 예후에 미치는 영향을 비교하여 분석해 보고자 시도하였다. 대상 및 방법:1996년 1월부터 2002년 3월까지 가톨릭대학교 성가병원에서 재태연령 35주미만에 출산한 산모 567명과 그 산모에서 태어난 신생아들의 병록지를 후향적으로 검토하였다. 전자간증 산모는 수축기 혈압 140이상, 확장기 혈압 90이상(6시간 간격으로 2회 이상 측정), 단백뇨가 24시간에 300mg 이상인 경우로 정의하였으며 대조군 산모와 함께 나이, 임신력, 조기양막 파수, 태반출혈(태반조기박리, 전치태반), 분만방법, 스테로이드 사용 등을 기록하였다. 다태아, 알려진 태아기형, 당뇨, 내과적 질병이 있는 경우는 제외되었다. 신생아에서는 출생체중, 재태연령, 1분·5분 Apgar 점수, 자궁내 성장지연, 호흡곤란증후군, 태아곤란증, 혈액 검사소견, 패혈증, 뇌실내 출혈, 신생아 사망, 재원일 수, 인공환기요법 기간 등에 대하여 조사 분석하였다. 결과: 1) 35주 이전 산모의 비교에서 전자간증 산모(n=97)와 대조군 산모(n=470)간 연령, 초산율, 태반출혈, 스테로이드 사용빈도에 유의한 차이가 없었다. 제왕 절개율은 전자간증 산모에서, 조기양막 파수는 대조군 산모에서 높은 비율을 나타내었다. 2) 35주 이전에 태어난 신생아의 비교에서 전자간증 산모의 미숙아는 대조군에 비하여 출생체중이 유의하게 적었으며 자궁내 발육지연과 태아 곤란증의 빈도, 1분 Apgar score 6점 이하의 비율이 유의하게 높았다. 재태 연령, 신생아 사망, 호흡곤란 증후군, 5분 Apgar score 6점 이하, 패혈증, 뇌실내 출혈, 인공환기요법, 입원일 수에 있어서 양군간에 유의한 차이가 없었다. 혈액학적 검사결과에서 혈소판 감소증, 백혈구 감소증, 제대혈의 PH가 양군간에 유의한 차이가 없었다. 3) 32주 이전 산모와 신생아를 대상으로 비교한 결과에서도 24~35주 신생아와 유사한 결론을 얻었다. 특히 호흡곤란 증후군은 32주 이전 전자간증 산모의 미숙아에서 발생률이 더 높았다. 결론: 모체의 전자간증이 미숙 신생아의 출생시 체중에 영향을 주나 임상 경과와 예후에는 영향을 미치지 않는 것으로 보이며 특히 신생아 호흡곤란 증후군의 발생을 저하시키지 않는 것으로 생각된다. Objective : The purpose of this study was to determine neonatal outcomes according to laboratory and clinical features in preeclampsia before 35 weeks gestation. Methods : The medical records of all patients delivered at the hospital from January 1, 1996 through March 31, 2002 were reviewed for the occurrence of preeclampsia before 35 weeks gestation. We compared their maternal medical and obstetric courses and neonatal outcomes with those in a group of non preeclamptic patients who delivered at similar gestational ages. Results : The preeclampsia group had lower mean birth weight, 1-minute Apgar score and umbilical arterial pH. But there were no difference in the incidence of neonatal death, respiratory distress syndrome, grade 3 and 4 intraventricular hemorrhage, and culture-proven sepsis. Results were similar when analysis was limited to infants born before 32 weeks. Conclusion : Maternal preeclampsia does not improve neonatal outcome of infants born before 35 weeks gestation.
중세시기 한국춤 시공간의 감응과 미학적 원리: 최한기의 감응기론을 중심으로
강주미 ( Kang Ju-mi ) 무용역사기록학회 2020 무용역사기록학 Vol.57 No.-
본 연구는 조선 후기 기철학자였던 혜강 최한기(崔漢綺, 1803-1879)의 감응기론(感應氣論)을 통해 중세시기의 한국춤 장소가 한국전통춤에 어떤 영향관계에 있었는지 살펴봄으로써 중세시기 한국춤 장소성의 미학적 감응원리를 고찰한다. 연구 방법으로는 고문헌 연구를 중심으로 삶의 연행 장소가 드러난 사료 추출을 하고, 최한기의 『신기통(神氣通)』과 『기학(氣學)』을 주 텍스트로 하면서 춤 시공간 논의의 이론적 토대를 삼고 인접 연구들을 참고하여 춤 시공간 논의의 이해를 확장한다. 고문헌 원문은 국사편찬위원회 데이터베이스 그리고 그 외의 고문헌들이 있는 한국고전종합 데이터베이스, 동양고전종합 데이터베이스를 활용하였고 검색어는 ‘무(巫), 무(舞), 춤’으로 한정하였다. 연구 결과 한국춤은 첫째, 전통사회 한국춤에서 시공간은 유기적으로 감응되고 있었다. 둘째, 전통사회에서 삶의 공간이 춤의 장소로 얽히어 있음을 확인하였다. 셋째, 전통사회의 춤 장소 중 ‘사이’라는 특수한 공간이 갖는 감응의 원리가 ‘소통’에 있었음을 미학적으로 해명할 수 있었다. 본 연구의 주요 개념인 장소성, 감응, 신기, 소통은 춤의 본성이 갖는 감응의 과정적, 결과적 의미들을 순환적으로 공유하는 개념들로서 오늘날의 춤 연행론에 학술 및 실천의 방향을 제시할 수 있을 것이다. This study aims to examine the aesthetic resonance principle of Korean dance by analyzing how the place of Korean dance in the Middle Ages was influenced by the effect of dance through the ‘ki (氣, energy)’ theory by philosopher Choi Han-gi (1803~1879). As a research method, records related to dance were selected from historical literature, and Choi Han-gi's books were used as main texts, and related discourses were referenced. The original texts of the old documents used online databases with major old documents such as the National History Compilation Committee database, and keywords were limited to ‘mu (巫, shaman)’, ‘mu (舞, dance)’, and ‘chum (춤, dance)’. The results of the study are as follows. First, Korean dance was organically adapted to the spacetime of traditional society. Second, it was confirmed that the space of life was entangled as a place of dance in the traditional society. Third, it was possible to aesthetically explain that the principle of resonance in a special space called “sai (사이, between)” among dance places in traditional society was in ‘communication’. The main keywords of this study ―placeness, resonance, singi (神氣, primal energy), communication― are concepts that share the meanings of resonance as the nature of dance. The keywords are expected to contribute a academic and practical direction for today's dance theory.
강주미(Kang, Ju mi) 민족미학회 2014 민족미학 Vol.13 No.1
이 글에서는 딜리의 분류에 의거했을 때 3기에 해당하는 작품들인 〈와호장룡〉(2000), 〈헐크〉(2003), 〈브로크백 마운틴〉(2005)을 중심으로 현상학, 해석학적 이해를 적용할 것이다. 이 글은 이안의 영상언어가 가지는 ‘몸’에 관한 의미의 지평을 확대 할 가능성을 발견하는 것에 의의를 두고자 한다. 이안은 존재함에 관한 실존적 좌표의 문제를 ‘몸’의 문제로 천착하고 있다. 그 이유는 디아스포라적 양상으로 배태되는 사건들은 반드시 ‘몸’이라는 실존의 문제를 빼놓고 생각할 수 없기 때문일 것이다. 이안의 3기 작품은 첫째, 〈와호장룡〉은 중력을 파괴함으로써 인간의 몸을 통해 비가시적 시공간을 가시화시켜준다. 또 억압적 몸의 반항을 통해 자유롭고자 욕망하는 여성의 몸을 보여준다. 둘째, 〈헐크〉의 상상적 몸을 통해 육체적 사유와 기억의 축적지로서 몸을 보여준다. 셋째, 〈브로크백 마운틴〉에서는 부정의 몸이 욕망하는 긍정적 몸을 보여준다. 더불어 언어화를 지양한 원초적 소통으로서의 영상적인 몸을 끌어 올린다. 결국 이안이 선택한 몸의 문제는 정착할 수 없는 이방인, 방황하는 중국인의 좌표를 다루는 것으로 의미가 확장될 수 있다. 그 이안의 영화에서 가공된 몸의 중심에는 항상 중국인의 정체성을 본질적으로 탐구하는 에너지를 안고 있다. 흩어진 민족의 아픔이 영상언어로서의 몸으로 침투해 들어와 고뇌하고 있다. 그들의 처지가 초국적인 만큼 그의 영화제작기법은 초국적이다. 그러나 이안의 중국문화의 정체성을 향한 열망은 강렬히 영상 언어화되어 있다. Based on the classification of Dilley, 〈Crouching Tiger, Hidden Dragon〉(2000), 〈Hulk〉(2003) and 〈Brokeback Mountain〉(2005) are classified film director Ang Lee’s ‘the films (Ⅲ)’. In this article, Ang Lee’s films (Ⅲ) will be discussed focusing on Phenomenological understanding. The significance of this article will be to find Ang Lee’s potential for expanding the horizon of the body. Ang Lee examines in depth the issue of existential coordinates with the body. The reason is that the events of the Diaspora must be understood with the body as the problem of existence. By destroying gravity, 〈Crouching Tiger, Hidden Dragon〉 visualizes the invisible space-time with the body. It shows the woman’s body desiring freedom through rebellion of oppressed body. Through the imaginary body, 〈Hulk〉 shows the body as physical thinking organ and memory storage. 〈Brokeback Mountain〉 shows the positive body being desired by the negative body. In addition, it avoids verbalizing and raises the body image as the primitive communication. The problems of body being chosen by Ang Lee treat unstable stranger and the coordinates of wandering Chinese. In the center of the body holds always energy exploring essentially Chinese identity. The pains of diasporic people permeate the body as a film language in anguish. The more transnational their situation, the more transnational their film making. Nevertheless, Ang Lee’s desire aiming at the identity of his Chinese culture is emerge from his films deeply.
가족력이 있는 열성경련에서 SCN1A 유전자의 돌연변이
강주미(Joo-Mee Kang),노석만(Suk-Man Roh),김영훈(Young-Hoon Kim),정승연(Seung-Yun Chung),이인구(In-Goo Lee),황경태(Kyung-Tai Whang) 대한소아신경학회 2003 대한소아신경학회지 Vol.11 No.1
목 적 ; 열성경련은 6세 이하 소아의 2-5%에서 경험하는 비교적 흔한 질환이다. 열성경련을 경험한 소아의 일부는 나중에 비열성 경련성질환과 간질로 발전한다. 전압관문 나트륨채널 아형(Voltage-gated sodium channel subunit) 유전자인 SCN1A의 돌연변이는 열성경련플러스(GEFS+)를 보이는 상염색체우성 전신간질과 중증 근간대성 간질을 보이는 영아의 열성경련과 관련이 있는 것으로 알려지고 있다. 저자들은 가족력이 있는 전형적인 열성경련아를 대상으로 SCN1B유전자의 돌연변이 여부를 알아보기 위하여 본 연구를 시행하였다. 방 법 : 가톨릭대학교 의정부성모병원 및 성모자애병원 소아과에서 가족력이 있는 열성경련으로 진단받은 환아 48명을 대상으로 하였다. 알려지지 않은 돌연변이를 밝히기 위하여 SCN1A 유전자 exon 9을 포함한 부분은 primer쌍(Foward GGAGGGTGAGACGCTGACTC, Reverse CACCTGGAGCTCCCCAGCTG)을 가지고 touchdown PCR방법을 수행하였으며 알려진 돌연변이를 발견하기 위하여 SCN1A유전자의 exon이 포함된 부분은 적절한 primer쌍을 이용하여 PCR을 시행하였다. 10개의 보고된 SCN1A 의 돌연변이는 SNaPshot 방법으로 수행하였다. 이상소견을 보인 DNA 조각은 염기서열 분석을 하였다. 결 과 : 대상 총 48명 중 단순 열성경련아는 30명(62.5%), 복함 열성경련아는 18명(37.5%)이었다. 연령 분포를 보면 12개월 미만 3명(6.3%), 12개월에서 36개월 미만 29명(60.4%), 36개월 이상 16명(33.3%)이었다. 남녀비는 0.66였다. 환아의 간질발작 양상으로는 전신 강직-간대발작 45명(93.8%), 근간대발작 1명(2.1%), 탈력발작 2명(4.2%)이었다. 뇌파소견은 정상 38명(79.2%)이었으며 약간의 비특이적인 이상을 보인 환아가 10명(20.9%)이었다. SNaPshot 방법과 염기서열분석을 통한 본 연구에서는 열성경련아 모두에서 SCN1B 유전자 돌연변이를 관찰할 수 없었다. 결 론 : 이러한 결과는 SCN1A가 흔한 열성경련에 관여하는 것은 흔하지 않다는 것을 보여주는 것으로 특별한 열성경련 유전자와 관련이 있음을 시사한다. Purpose : Febrile seizures affect 2-5% of all children younger than 6 years old. A small proportion of children with febrile seizures later develop epilepsy. Muations in the voltage-gated sodium channel subunit gene SCN1A have been associated with febrile seizures(FSs) in autosomal dominant generalized epilepsy with febrile seizures plus(GEFS+) families and severe myoclonic epilepsy of infancy. The present study assessed the role of SCN1A in familial typical FSs. Methods : Forty-eight familial FSs were selected throughout a collaborative study of Catholic Child Neurology Research Group. To identify unknown mutations, regions containing the exons for SCN1A gene was performed with two primer(Foward GGAGGGTGAGACGCTGACTC, Reverse CACCTGGAGCTCCCCAGCTG) by touchdown PCR method, and to identify known mutations, regions containing exons of the SCN1A gene were amplified by PCR using suitable primer sets. Ten reported mutations of SCN1A were screened by SNaPshot method. DNA fragments showing variant chromatograms were subsequently sequenced. Results : Among 48 FS patients, thirty(62.5%) showed simple FSs, and eighteen(37.5%) had complex FS+. Three patients(6.3%) were younger than 12 months old, twentynine(60.4%) between 12 and 36 months old, and sixteen(33.3%) older than 36 months old. The ratio of female to male was 0.66:1.0. In the phenotypes of FSs, forty-five patients(93.8%) had generalized tonic-clonic seizures, one patient(2.1%) myoclonic seizures and two patients(4.2%) atonic seizures. In EEG findings of FSs, thirty-eight(79.2%) patients had normal findings, and ten(20.9%) patients had mild aspecific abnormalities. Mutational analysis detected no mutations of SCN1A. Conclusion : Our study demonstrated that SCN1A is not frequently involved in common FSs and suggested any involvement of specific FS genes.